Youblisher.com-683392-Manual de Participante Cedula A

  • Published on
    21-Oct-2015

  • View
    33

  • Download
    0

Transcript

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CCCC

    CCCCGGGGCTCTCTCTTTTT1

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    INTRODUCCION

    Se denomina Agentes de Seguros de Vida al que ha preparado para hacer dela venta de seguros una profesin. Si estuviramos en posibilidades de realizarun estudio, descubriramos que es fabulosa la cantidad de agentes de segurosque se adjudican este ttulo an careciendo de los conocimientos mselementales del seguro.

    La personalidad profesional de un individuo se desarrolla en dos etapas: La primera consiste en la adquisicin de conocimientos La segunda en la aplicacin de esos conocimientos, transformados omodificados despus de su contacto con lo que es esencial en cada hombre.

    CCCC

    CCCCGGGGCTCTCTCTTTTT2

    En virtud de los cambios que hoy enfrentamos en el sector asegurador enmateria de capacitacin, nuestro equipo se ha dado a la tarea de establecer unaestrategia cuyo objetivo fundamental es brindar o fortalecer sus conocimientostcnicos, jurdicos, operativos relacionados con las operaciones de vida, daosy accidentes personales, que le facilite acreditar su capacidad tcnica a travsde la sustentacin del examen ante la Comisin Nacional de Seguros y deFianzas, para la obtencin o refrendo de la cdula tipo A, ante la ComisinNacional de Seguros y de Fianzas.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CONTENIDOASPECTOS GENERALES

    I.MARCO JURIDICO............................................................................................... 5

    I.1 LEY GENERAL DE INSTITUCIONES Y SOCIEDADES MUTUALISTAS ............................................... 8 DE SEGUROS

    I.2 LEY SOBRE EL CONTRATO DE SEGUROS .......................................................................................... 28I.3 REGLAMENTO DE AGENTES DE SEGUROS Y DE FIANZAS................................................................ 41I.4 LEY DE PROTECCIN Y DEFENSA AL USUARIO DE

    SERVICIOS FINANCIEROS...................................................................................................................... 45I.5 OPERACIN PARA LA PREVENCIN Y DETECCIN DE

    OPERACIONES DE PROCEDENCIA ILICITA......................................................................................... 49I.6 SISTEMA FINANCIERO MEXICANO ..................................................................................................... . 53I.6.1 LAS INSTITUCIONES QUE OPERAN EN EL SISTEMA FINANCIERO, SU PRPSITO Y RELACION

    ENTRE S ..................................................................................................................................................54I.6.2 TIPOS DE INTERMEDIARIOS FINANCIEROS Y LAS DIFERENCIAS ENTRE ELLOS..........................55I.6.3 RELACION ENTRE LAS AUTORIDADES, INSTITUCIONES E INTERMEDIARIOS DEL SISTEMA

    FINANCIERO .......................................................................................................................................... 55

    CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO

    CCCC

    CCCCGGGGCTCTCTCTTTTT3

    FINANCIERO .......................................................................................................................................... 55I.6.4 SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DE CRDITO.................................. 56I.6.5 SECTOR BURSATIL................................................................................................................................ 57I.6.6 SEGUROS Y FIANZAS........................................................................................................................... 58I.6.7 SISTEMAS DE AHORRO PARA EL RETIRO .........................................................................................581.6.8 SISTEMAS DE APOYO...........................................................................................................................59I.6.9 TERMINOLOGA BSICA....................................................................................................................... 60I.6.10 RELACION CON LOS SEGUROS QUE CONTEMPLAN INVERSIN................................................... 66

    II.ASPECTOS TCNICOS....................................................................................... 80II.1 RIESGO.....................................................................................................................................................83II.2 COSTO DEL SEGURO.............................................................................................................................. 87II.3 SINIESTRO.................................................................................................................................................93

    III ASPECTOS OPERATIVOS................................................................................. 74

    III.1 DEL AGENTE............................................................................................................................................97III.2 DE LA ASEGURADORA...........................................................................................................................99III.3 ANTE LAS AUTORIDADES......................................................................................................................103

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CONTENIDO

    RIESGOS INDIVIDUALES DEL SEGURO DE PERSONAS

    IV. VIDA INDIVIDUAL.............................................................................................107

    IV.1 BASES TECNICAS....................................................................................................................................108IV.2 CONDICIONES GENERALES DE LA POLIZA..........................................................................................115IV.3 TIPOS DE PLANES....................................................................................................................................118IV.4 BENEFICIOS Y CLAUSULAS ADICIONALES........................................................................................... 121

    V. ACCIDENTES Y ENFERMEDADES................................................................ 129

    V.1 ACCIDENTES PERSONALES.................................................................................................................... 131V.2 GASTOS MEDICOS MAYORES................................................................................................................. 134V.3 SALUD......................................................................................................................................................... 141

    RIESGOS INDIVIDUALES DEL SEGURO DE DAOS

    CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO

    CCCC

    CCCCGGGGCTCTCTCTTTTT4

    V. AUTOMOVILES................................................................................................. 146

    V.1 CONCEPTOS BASICOS........................................................................................................................... 147V.2 ESTRUCTURA DE LA POLIZA................................................................................................................. 150V.3 SINIESTROS............................................................................................................................................ 156

    VI. POLIZA HOGAR ............................................................................................. 160

    VI.1 CONCEPTOS BASICOS............................................................................................................................ 161VI.2 ESTRUCTURA DE LA POLIZA..................................................................................................................162VI.3 SINIESTROS..............................................................................................................................................175

    VII. EMBARCACIONES MENORES DE PLACER ............................................. 177

    VII.1 CONCEPTOS BASICOS.......................................................................................................................... 178VII.2 ESTRUCTURA DE LA POLIZA.................................................................................................................181VII.3 SINIESTROS.............................................................................................................................................183

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CCCC

    CCCCGGGGCTCTCTCTTTTT5

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.1 INTRODUCCIONAUTORIDADES Y DISPOSICIONES LEGALES

    Desde sus inicios, hasta nuestros das, elhombre ha evolucionado y revolucionadosu entorno social; ha sido capaz demodificar su universo y dimensionar supropia existencia.El hombre se ha dado cuenta de que lanecesidad de seguridad es inherente,desde su origen, a l mismo y siente, porsus propias limitaciones, menester desalvaguardarse frente al medio en que sedesenvuelve.Esta necesidad de proteccin la haceextensiva a los suyos, su familia, sucomunidad y su pas. Se proteger ensu persona y en sus bienes contra lasconsecuencias econmicas daosas porlas posibles prdidas que le produzcanlos riesgos que le rodean y amenazan.As, a travs de diferentes caminos, vabuscando la suplencia de laincertidumbre, de lo desconocido. Este

    NECESIDAD DE SEGURIDAD

    DE SU PERSONA

    DE SU FAMILIA

    DE SUS COSAS

    ACTIVIDAD ASEGURADORA

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT6

    incertidumbre, de lo desconocido. Estehecho ha dado como consecuencia lacreacin, formacin, perfeccin ydesarrollo de la Actividad Aseguradora.Cuando se habla de la actividadaseguradora, se est hablando entrminos de Institucin Jurdica, la cualse refiere a todas las figuras dotadas depersonalidad jurdica que lo componencomo:

    El asegurador, El asegurado,intermediario del contrato de cobertura,Los Reaseguradores, Los Ajustadores deSiniestros y las autoridades que loregulan conforme a derecho.El seguro se ha convertido en Seguro deEmpresa, es decir, solamente lo otorganpersonas morales que son sociedades,con fines lucrativos o no, pero que estnconstituidas como empresas conforme ala Legislacin Mexicana.La amplitud requerida en el seguro,debido a la variedad de riesgos porcubrir, lleva a esta Institucin Jurdica arequerir de la aplicacin DE LEYESCOMPLEMENTARIAS YSUPLEMENTARIAS, y a la creacin deReglamentos de las propias leyesespecficas que implementen suaplicacin.

    INSTITUCION JURIDICA

    ASEGURADO INTERMEDIARIO

    AUTORIDADES QUE REGULAN LA ACTIVIDAD

    REASEGURADORES

    AJUSTADORES

    LA INSTITUCION JURIDICA REQUIERE DE :

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LAS LEYES Y REGLAMENTOS queconforman el derecho en Seguros,aplicables en Mxico son:

    1.- Ley General de Instituciones ySociedades Mutualistas de Seguros

    2.- Ley Sobre el Contrato de Seguros3.-Reglamento de Agentes de Seguros y

    de Fianzas4.-Reglamento de Seguro de Grupo

    Como Leyes Complementarias y/oSuplementarias, ya que contienenconceptos especficos o relacionadosen materia de Seguros, se debentomar en cuenta las siguientes:

    1.- Cdigo Civil2.-Cdigo Civil de Comercio3.-Ley de Proteccin y Defensa al

    Usuario de Servicios Financieros4.-Ley de Navegacin5.-Ley de Vas Generales de

    Comunicacin.

    INSTITUCIONES QUE REGULAN LA ACTIVIDAD ASEGURADORA EN MEXICO

    L.G.I.S.M.S.Ley General de Instituciones y

    Sociedades Mutualistas de Seguros

    Su objetivo principal es la proteccin de losintereses del pblico usuario de estosservicios, por lo que regulan a:

    Las empresas que se organicen y funcionencomo Instituciones de Seguro y SociedadesMutualistas

    Las Actividades y operaciones que lasmismas realicen

    Las actividades y operaciones de los agentesde seguros

    Las actividades y funciones de las dems

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT7

    Comunicacin.Existen otras Leyes que por sus

    caractersticas y aplicabilidad, tienenque ver con el mbito de la ActividadAseguradora, mencionaremos algunas:

    Ley de Navegacin y Comercio Martimo Ley del Banco de Mxico Ley General de Sociedades Mercantiles Ley de Instituciones de Crdito Ley General de ttulos y Operaciones de

    Crdito Ley General de Organizaciones y

    Actividades Auxiliares de Crdito Ley del Mercado de Valores Ley Monetaria de los Estados Unidos

    Mexicanos Ley de Sociedades de Inversin Ley de Inversin Extranjera Ley de Agrupaciones Financieras. Ley Fiscal Federal Ley Federal del Trabajo Ley del Seguro Social Ley de los Sistemas de Ahorro para el

    Retiro Ley General de Salud

    Las actividades y funciones de las demspersonas relacionadas con la actividadaseguradora

    Los lineamientos que debe seguir una empresa para constituirse como Aseguradora son:

    LAS OPERACIONES Y RAMOS QUE VAN A TRABAJARLOS REQUERIMIENTOS MINIMOS FINANCIEROS COMO EL CAPITAL MINIMO DE GARANTIA. EL PORCENTAJE DE LA PRIMA PARA LA CONSTITUCIN DE LAS RESERVAS TECNICAS Y LA FORMA DE CONTABILIZAR SUS CUENTAS

    LOS DIRECTIVOS QUE DEBEN EXISTIR PARA ADMINISTRARLALA FORMA EN QUE SE DEBEN ESTRUCTURAR SUS POLIZASNOTAS TECNICAS.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.2 LEY GENERAL DE INSTITUCIONES Y SOCIEDADES MUTUALISTAS DE SEGUROSOPERACIONES Y RAMOSREQUISITOS Y RESTRICCIONES DE LEYPROHIBICIONES PARA LA COMERCIALIZACIONTIPOS DE CONTRATOSINFRACCIONES DEL AGENTEREQUISITOS PARA COBRO DE COMISIONES

    Es una institucin constituida como sociedadannima, cuya funcin principal es la de asumirriesgos mediante el pago de una prima.

    Es la entidad aseguradora formada por laasociacin de personas que se reparten entre slos riesgos que individualmente les corresponden.Puede ser a prima fija, prima variable oproporcional.

    ARTICULO 7o. - Las autorizaciones paraorganizarse y funcionar como institucin osociedad mutualista de seguros, son por supropia naturaleza intransmisibles y sereferirn a una o ms de las siguientesoperaciones de seguro:I. - Vida;II.- Accidentes y enfermedades, en alguno oalgunos de los ramos siguientes:a).- Accidentes personales;b). - Gastos mdicos; yc). - Salud;III. - Daos, en alguno o algunos de los ramossiguientes:a). -Responsabilidad civil y riesgos profesionales;b). - Martimo y transportes;c). - Incendio;d). - Agrcola y de animales;

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT8

    d). - Agrcola y de animales;e). - Automviles;f). - Crdito;g).- Diversos;h).- Terremoto y otros riesgos catastrficos; yi).- Los especiales que declare la Secretara deHacienda y Crdito Pblico, conforme a lodispuesto por el artculo 9o. de esta Ley.Las autorizaciones podrn otorgarse tambin parapracticar exclusivamente el reaseguro, en alguna oalgunas de las operaciones mencionadas en esteartculo o conforme a lo sealado en el artculo76A de esta ley.Tratandose de los seguros relacionados concontratos de seguros que tengan como baseplanes de pensiones o de superviviencia derivadosde las leyes de seguridad social a los que serefiere el prrafo segundo de la Freccin I del art.8 de esta ley, las autorizaciones se otorgarn soloa Instituciones de Seguros que las prctiquen enforma exclusiva sin que a las mismas se les puedaautorizar cualquiera otra operacin de lassealadas en este artculo.El ramo de salud a que se refiere en inciso Cfraccin II de este artculo y la fraccin V delartculo 8. de esta ley solo deber practicarse porInstituciones de Seguros, autorizadasexclusivamente para este efecto y a las cualesunicamente se les podr autorizar a practicar demanera adicional, el ramo de gastos mdicos. Laoperacin y desarrollo del ramo de salud estarsujeto a las disponsiciones de carcter general queemita la S.H.C.P., previa opinin de la C.N.S.F. Yde la Secretara de Salud.Las autorizaciones otorgadas a las Instituciones deSeguros podrn comprender la prctica de lasoperaciones de reafianzamiento en los trminosdel artculo sexto de esta ley.

    AUTORIZACIONES INTRANSMISIBLESSON

    OPERACIONES

    A. ACCIDENTES PERSONALES

    B. GASTOS MEDICOSC. SALUD

    A. RESPONSABILIDAD CIVIL Y RIESGOS PROFESIONALESB. MARITIMO Y TRANSPORTEC. INCENDIOD. AGRICOLA Y DE ANIMALESE. AUTOMOVILESF. CREDITOG. DIVERSOSH. TERREMOTO Y OTROS RIESGOS CATASTROFICOSI. LOS ESPECIALES QUE DECLARE LA S.H.C.P. (ART. 9o. de

    esta Ley)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    R.A.S.F.ARTCULO 6o.-Los agentes yapoderados de seguros, en elejercicio de las actividades deintermediacin, debern apegarsea las tarifas, plizas, endosos,planes de seguro y demscircunstancias tcnicas utilizadaspor las Aseguradoras en loscontratos de seguros.Los agentes y apoderados deseguros, proporcionarn a lasAseguradoras la informacinautntica que sea de suconocimiento, relativa al riesgocuya cobertura se proponga, a finde que las mismas puedan formarun juicio sobre sus caractersticasy fijar conforme a las normasrespectivas, las condiciones yprimas adecuadas.

    REQUISITOS Y RESTRICCIONES PARA SER AGENTE DE SEGUROS

    LOS AGENTES Y APODERADOS DE SEGUROS EN EL EJERCICIO DE SU

    ACTIVIDAD DE INTERMEDIACIONDEBERAN:

    APEGARSE A lastarifas, plizas,endosos, planes deseguro

    y dems circunstanciastcnicas utilizadas porlas Aseguradoras en loscontratos de seguros.

    PROPORCIONAR alas Aseguradoras lainformacin autnticaque sea de suconocimiento,relativa al riesgo cuya coberturase proponga, a fin de que lasmismas puedan formar un juiciosobre sus caractersticas y fijarconforme a las normasrespectivas, las condiciones yprimas adecuadas.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT9

    R.A.S.ARTCULO 9o.- Para actuarcomo agente o apoderado serequerir autorizacin de laComisin, la cual tendr elcarcter de instransferible y podrotorgarse para realizar actividadesde intermediacin en lasoperaciones, y ramos, en el casode seguros, y en los ramos ysubramos en el caso de fianzas,que determine la propia Comisin.Las autorizaciones que otorgue laComisin a personas morales, seharn constar en oficio que expidala Comisin y en cdula las queotorgue a agentes personas fsicaso apoderados.

    Tendr carcter de intransferible.Podr intermediar en las operaciones, ramos y subramosque determine la propia Comisin.(Podr otorgarse para realizar actividades de intermediacin en lasoperaciones y ramos, en el caso de seguros y en los ramos y subramos en elcaso de fianzas)

    Cdula Definitiva

    Para actuar como agente o apoderado, se requerir autorizacin de la Comisin

    QUIEN AUTORIZA

    La autorizacin que se otorgue a personas morales, se har constar en oficio expedido por la COMISION

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTCULO 10.- Para obtener laautorizacin de agente persona fsica oapoderado se requerir:I.- Ser mayor de edad;II.- En caso de ser extranjero deber contar conla documentacin que compruebe la calidadmigratoria que le permite actuar en el pascomo agente;III.- No tener alguno de los impedimentos a quese refiere el artculo 13 del presenteReglamento;IV.- Haber concluido estudios de preparatoria oequivalentes, yV.- Acreditar ante la Comisin que se cuentacon la capacidad tcnica para ejercer lasactividades de intermediacin a que se refiereeste Reglamento.

    La Comisin tendr la facultad de evaluarla capacidad tcnica de las personas quesoliciten la autorizacin o refrendo comoagentes personas fsicas o apoderadosque establece este Reglamento, mediantela aplicacin de exmenes ante la misma

    REQUISITOS Y RESTRICCIONES PARA SER AGENTE DE SEGUROS

    I. Ser mayor de edad;II. En caso de ser extranjero deber contar con la documentacin que

    compruebe la calidad migratoria que le permite actuar en el pascomo agente;

    III. No tener alguno de los impedimentos a que se refiere el artculo 13del presente Reglamento;

    IV. Haber concluido estudios de PREPARATORIA OEQUIVALENTE, y

    V. Acreditar ante la Comisin que se cuenta con la capacidad tcnicapara ejercer las actividades de intermediacin a que se refiere esteReglamento.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT10

    la aplicacin de exmenes ante la mismao las personas morales que designe paratal efecto.La Comisin sealar los documentos einformacin que debern proporcionarsecon la solicitud de autorizacin o refrendopara ejercer las actividades deintermediacin.

    ARTCULO 11.- Tratndose de personasfsicas vinculadas a las Instituciones poruna relacin de trabajo, que pretendanejercer las actividades de intermediacin,la autorizacin correspondiente deber sersolicitada por conducto de las propiasInstituciones.

    En el caso de apoderados, la autorizacincorrespondiente deber ser solicitada porconducto de los agentes personasmorales.

    Los agentes personas fsicas vinculados auna Institucin por una relacin de trabajo,no podrn prestar sus servicios para otrasInstituciones. Asimismo desempearnsus labores en la forma horario y lugarconvenidos con la Institucin y estarnsujetos a las directrices, instrucciones onormas de la misma.

    LA AUTORIZACION PARA REALIZAR ACTIVIDADES DE INTERMEDIACIONANTE LA C.N.S.F. LA DEBERA HACER LA INSTITUCION O LA PERSONAMORAL.

    PERSONA MORALINSTITUCION

    INTERMEDIARIOVINCULADA

    Contrato Mercantil (Agente Independiente o por cuenta propia)Contrato Laboral (Agente Empleado)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    R.A.S.F.

    ARTCULO 12.- Para obtener laautorizacin respectiva, los agentespersonas morales debern estarconstituidos como S.A. Con arreglo a loque dispone la Ley General deSociedades Mercantiles, en cuanto noeste previsto en el presente reglamentoy particularmente, a las siguientesbases:...............................

    ARTCULO 13.- No se otorgar autorizacinpara operar como agente o apoderado a:I.- Quien no rena los requisitos que sealaeste Reglamento;II.- Quien hubiere sido condenado por undelito patrimonial intencional o contra lasalud;III.- Quien hubiere sido declarado sujeto aconcurso mercantil, suspensin de pagos oquiebra, sin haber sido rehabilitado;

    REQUISITOS Y RESTRICCIONES PARA SER AGENTE DE SEGUROS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    1. Tendrn por objeto ejercer las actividades de intermediacin as como aqullosactos que son compatibles, anlogos o conexos. La intermediacin solo atravsde intermediarios (apoderados)

    2. Su denominacin deber de ir seguida de la expresin (Agente de Seguros,Agente de Fianzas Agente de Seguros y de Fianzas, segn corresponda.

    3. Debern tener ntegramente pagado el capital mnimo que fije la Comisin.4. La escritura constitutiva y cualquier modificacin a la misma deber ser

    sometida a la aprobacin de la Comisin, dictada dicha aprobacin la escritura osus reformas podrn ser inscritas en el registro pblico de comercio.

    5. En sus estatutos sociales debern establecer que en ningn momento podrnparticipar en su capital pagado directamente o a travs de interpsita personas.

    A. Las Instituciones de Crdito, Las Instituciones y SociedadesMutualistas de Seguros, Instituciones de Fianzas, Casas de Bolsa,Especialistas Burstiles, Organizaciones Auxiliares de Crdito,Sociedades de Inversin especializadas para el fondo para el retiroentre otros, sujetos a autorizacin por la autoridad correspondiente.

    B. Gobiernos o Dependencias oficiales extranjeros o EntidadesFinancieras del Exterior

    C. Sociedades Controladoras a que se refiere la Ley para regular lasagrupaciones financieras.

    CCCC

    CCCCGGGGCTCTCTCTTTTT11

    quiebra, sin haber sido rehabilitado;IV.- Los servidores pblicos de laFederacin, del Gobierno del DistritoFederal, de los Estados o Municipios, salvoque realicen una labor exclusivamenteacadmica.Se excepta de lo dispuesto en el prrafoanterior a los servidores pblicos deinstituciones nacionales de seguros o defianzas que realicen actividades de agentesde seguros o de fianzas, como personasfsicas sujetos a una relacin de trabajo condichas instituciones;V.- Los funcionarios y empleados deInstituciones de Crdito, Instituciones ySociedades Mutualistas de Seguros,Instituciones de Fianzas, casas de bolsa,especialistas burstiles, organizacionesauxiliares del crdito, sociedades deinversin, sociedades operadoras desociedades de inversin, casas de cambio,comisionistas financieros, administradorasdel fondo para el retiro, sociedades deinversin especializadas en fondo para elretiro, as como sociedades que a su vezcontrolen el diez por ciento o ms de lasacciones representativas del capital pagadode dichas empresas.

    D. Las personas fsicas o morales propietarias de acciones de unaInstitucin de Seguros o de Fianzas, salvo que intervengan porconducto de Sociedades de Inversin o de Fideicomisos, constituidospara ese nico fin.

    E. Las Personas que se ubiquen en alguno de los supuestos deimpedimentos para ser agente establecidos en las fracciones IV , V, X,XI del artculo 13 de este Reglamento y

    F. Los agentes apoderados o accionistas de agentes personas morales,autorizados para intermediar el Seguros de Pensiones Derivados de lasLeyes de Seguridad Social, con una Aseguradora Distinta a la quepreste estos servicios la propia Sociedad.

    6. En los estatutos sociales se deber especificar las operaciones y ramos en elcaso de Seguros y los Ramos y Subramos, en el caso de Fianzas, quepretenden intermediar y para el caso de los Seguros de Pensiones derivados dela Seguridad Social, se establecer que slo podrn intermediar con una solapersona.

    7. El nmero de sus administradores no ser inferior a tres y8. Debern tener apoderados que cuenten con autorizacin de la Comisin para

    realizar de manera conjunta o individual todas las actividades de intermediacin,en las operaciones y ramos, en el caso de Seguros, en los ramos y subramosen el caso de Fianzas, que tenga autorizados la Sociedad. En los casos en quela Sociedad establezca oficinas en otras localidades distintas en su domiciliosocial, deber contar por lo menos con un apoderado en cada una de estas.La Comisin podr acordar que se proceda a la remocin o suspensin de losmiembros del Consejo de Administracin, Comisarios, Directores, Gerentes,Representantes Legales y Funcionarios que puedan obligar con su firma a laSociedad, cuando considere que tales designaciones no corresponden apersonas con la suficiente calidad moral o tcnica para la adecuadaadministracin y vigilancia de la sociedad, oyendo previamente a sta, a travsde su represenante legal, as como al interesado.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTCULO 13.- No se otorgar autorizacinpara operar como agente o apoderado a:I.- Quien no rena los requisitos que sealaeste Reglamento;II.- Quien hubiere sido condenado por undelito patrimonial intencional o contra la salud;III.- Quien hubiere sido declarado sujeto aconcurso mercantil, suspensin de pagos oquiebra, sin haber sido rehabilitado;IV.- Los servidores pblicos de la Federacin,del Gobierno del Distrito Federal, de losEstados o Municipios, salvo que realicen unalabor exclusivamente acadmica.Se excepta de lo dispuesto en el prrafoanterior a los servidores pblicos deinstituciones nacionales de seguros o defianzas que realicen actividades de agentesde seguros o de fianzas, como personasfsicas sujetos a una relacin de trabajo condichas instituciones;V.- Los funcionarios y empleados deInstituciones de Crdito, Instituciones ySociedades Mutualistas de Seguros,Instituciones de Fianzas, casas de bolsa,especialistas burstiles, organizacionesauxiliares del crdito, sociedades deinversin, sociedades operadoras desociedades de inversin, casas de cambio,

    A QUIEN NO SE LE OTORGARA AUTORIZACION PARA OPERAR COMO AGENTE O APODERADO?

    Que no renan los requisitos de este Reglamento.Los condenados por un delito patrimonial intencional ocontra la saludLos Servidores Pblicos de la Federacin, del Gobiernodel Distrito Federal, de los Estados o Municipios salvoque realicen una labor exclusivamente acadmica.Los representantes legales de InstitucionesReafianzadoras o ReaseguradorasLas personas que hayan sido sancionadas con larevocacinQuienes por su posicin o por cualquier circunstancia ajuicio de la Comisin, pueda influir o ejercer coaccinpara la contratacin de seguros o de fianzas.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT12

    sociedades de inversin, casas de cambio,comisionistas financieros, administradoras delfondo para el retiro, sociedades de inversinespecializadas en fondo para el retiro, ascomo sociedades que a su vez controlen eldiez por ciento o ms de las accionesrepresentativas del capital pagado de dichasempresas.

    ARTCULO 16.- Las Institucionesrespondern por los actos que realicen laspersonas que, con el consentimiento deaquellas, realicen las actividades deintermediacin, sin contar con laautorizacin requerida por este Reglamento.Lo anterior, sin perjuicio de la aplicacin delas sanciones administrativascorrespondientes.

    ARTCULO 17.- Los agentes respondernpor los actos que realicen las personas que,con el consentimiento de aquellos, realicenlas actividades de intermediacin, sin contarcon la autorizacin requerida por esteReglamento. Lo anterior, sin perjuicio de laaplicacin de las sanciones administrativascorrespondientes.

    RESPONDERANPOR LOS ACTOS QUE REALICEN LAS PERSONASQUE, CON EL CONSENTIMIENTO DE ELLAS REALICENLAS ACTIVIDADES DE INTERMEDIACION, SIN CONTARCON LA AUTORIZACION RESPECTIVA.

    RESPONDERANPOR LOS ACTOS QUE REALICEN LASPERSONAS QUE, CON SU CONSENTIMIENTOREALICEN LAS ACTIVIDADES DEINTERMEDIACION, SIN CONTAR CON LAAUTORIZACION RESPECTIVA.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LGISMSARTICULO 3o. - En materia de actividadaseguradora:I.- Se prohibe a toda persona fsica o moraldistinta de las sealadas en el articulo 1o.de esta ley, la prctica de cualquieraoperacin activa de seguros en territoriomexicano;Para efectos de esta ley, se considera que serealiza una operacin activa de seguroscuando, en caso de que se presente unacontecimiento futuro e incierto, previsto por laspartes, una persona, contra el pago de unacantidad de dinero, se obliga a resarcir a otraun dao, de manera directa o indirecta o apagar una suma de dinero.No se considerara operacin activa de segurosla comercializacin a futuro de bienes oservicios, cuando el cumplimiento de laobligacin convenida, no obstante que dependade la realizacin de un acontecimiento futuro eincierto, se satisfaga con recursos einstalaciones propios de quien ofrece el bien oel servicio y sin que se comprometa a resarciralgn dao o a pagar una prestacin en dinero;La Secretaria de Hacienda y Crdito Pblico,oyendo la opinin de la Comisin Nacional deSeguros y Fianzas, podr establecer criteriosde aplicacin general conforme a los cuales seprecise si una operacin, para efectos de este

    OPERACIN ACTIVA DE SEGUROSEn caso de que se presente un acontecimiento futuro eincierto, previsto por las partes, una persona, contra elpago de una cantidad de dinero, se obliga a resarcir aotra un dao, de manera directa o indirecta o a pagaruna suma de dinero.

    Se prohibe a toda persona fsica o moral distintade las sealadas en el artculo 1o. De esta ley,la prctica de cualquiera operacin activa deseguros en territorio mexicano;

    Se prohbe contratar con empresasextranjeras: Seguros de personas, si el asegurado se

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT13

    precise si una operacin, para efectos de estearticulo, se considera operacin activa deseguros, y deber resolver las consultas que alefecto se le formulen.

    II.- Se prohibe contratar con empresasextranjeras:1).- Seguros de personas cuando el aseguradose encuentre en la repblica al celebrarse elcontrato;

    2R).- A la persona que compruebe que ningunade las empresas aseguradoras facultadas paraoperar en el pas, pueda o estime convenienterealizar determinada operacin de seguro queles hubiera propuesto. En este caso, seotorgara una autorizacin especfica para quelo contrate con una empresa extranjera,directamente o a travs de una institucin deseguros del pas, y3).- Seguros de cascos de naves o aeronaves yde cualquier clase de vehculos, contra riesgospropios del ramo martimo y de transportes,siempre que dichas naves, aeronaves ovehculos sean de matricula mexicana opropiedad de personas domiciliadas en larepblica;4).- Seguros de crdito, cuando el aseguradoeste sujeto a la legislacin mexicana;5).- Seguros contra la responsabilidad civil,derivada de eventos que puedan ocurrir en larepblica; y

    encuentra en la Repblica. Si el aseguradocomprueba que ninguna aseguradora leconvence en sus ofertas, la S.H.C.P. Leotorgar una autorizacin especial paracontratar con una aseguradora extranjera.

    Seguros de cascos de naves o aeronavesy de cualquier vehculo, si estos tienenmatricula mexicana o son propiedad depersonas domiciliadas en la repblica

    Seguros de crdito, cuando el aseguradoeste sujeto a la legislacin mexicana.

    Seguros de responsabilidad civil,derivados de eventos que puedan ocurriren territorio mexicano

    Seguros de los dems ramos contra riesgosque puedan ocurrir en territorio mexicano

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    6).- Seguros de los dems ramos contrariesgos que puedan ocurrir en territoriomexicano. No se consideraran como tales losseguros que no residentes en territoriomexicano contraten fuera del mismo para suspersonas o sus vehculos, para cubrir riesgosdurante sus internaciones eventuales.III.- En los siguientes casos, la Secretara deHacienda y Crdito Pblico podr exceptuar delo dispuesto en las fracciones anteriores:1).- A las empresas extranjeras que, previaautorizacin de la citada Secretara ycumpliendo con los requisitos que la mismaestablezca, celebren contratos de seguros enterritorio nacional, que amparen aquellosriesgos que solo puedan ocurrir en los paisesextranjeros en donde estn autorizadas paraprestar servicios de seguros.La Secretaria de Hacienda y Crdito Pblico,previa opinin de la Comisin Nacional deSeguros y Fianzas, podr revocar laautorizacin otorgada en los trminos delprrafo anterior, cuando considere que estnen peligro los intereses de los usuarios de losservicios de aseguramiento, oyendopreviamente a la empresa de que se trate; y2).- A la persona que compruebe que ningunade las empresas aseguradoras facultadas paraoperar en el pas, pueda o estime conveniente

    PROHIBICIONES LEGALES PARA LA COMERCIALIZACION DEL SEGURO

    La S.H.C.P. Podr exceptuar de lo dispuesto en las fracciones anteriores en los siguientes casos:

    A empresas extranjeras, para que celebrencontratos de seguros que amparen riesgos quesolo puedan ocurrir en los pases extranjerosdonde estn autorizadas.

    A la persona que compruebe que ningunaaseguradora facultada puede realizardeterminada operacin de seguros que leshubiere propuesto (en este caso recibir unaautorizacin para contratar con una empresaextranjera)

    Se prohbe a toda persona ofrecer directamente ocomo intermediario, en territorio nacional, por

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT14

    operar en el pas, pueda o estime convenienterealizar determinada operacin de seguro queles hubiera propuesto. En este caso, se podrotorgar discrecionalmente una autorizacinespecifica para que lo contrate con unaempresa extranjera, directamente o a travs deuna Institucin de Seguros del pas; yIV.- Se prohibe a toda persona ofrecerdirectamente o como intermediario, en territorionacional, por cualquier medio pblico o privado,las operaciones a que se refieren el primerprrafo de la fraccin I y la fraccin II de esteartculo, as como seguros sobre bienes que setrasporten en territorio mexicano que setransporten a territorio extranjero y viceversa.Los contratos concertados contra lasprohibiciones de este articulo, no producirnefecto legal alguno, sin perjuicio del derechodel contratante o asegurado de pedir elreintegro de las primas pagadas eindependientemente de las responsabilidadesen que incurra la persona o entidad de que setrate, frente al contratante, asegurado obeneficiario o sus causahabientes, de buena fey de las sanciones a que se haga acreedoradicha persona o entidad en los trminos deesta ley.Lo dispuesto en el prrafo anterior no esaplicable a los seguros contratados con laautorizacin especifica de la Secretaria deHacienda y Crdito Pblico, a que se refiereeste artculo.

    como intermediario, en territorio nacional, porcualquier medio publico o privado, las operaciones aque se refieren el primer prrafo de la fraccin i y lafraccin II de este artculo.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 23. - Para los efectos de esta Ley, seconsiderarn agentes de seguros las personas fsicaso morales que intervengan en la contratacin deseguros mediante el intercambio de propuestas yaceptaciones, y en el asesoramiento para celebrarlos,para conservarlos o modificarlos, segn la mejorconveniencia de los contratantes.La intermediacin de contratos de seguro que notengan el carcter de contratos de adhesin, estreservada exclusivamente a los agentes de seguros;la intermediacin de los que tengan ese carctertambin podr realizarse a travs de las personasmorales previstas en el ltimo prrafo del artculo 41de esta Ley.Para el ejercicio de la actividad de agente de seguros,se requerir autorizacin de la Comisin Nacional deSeguros y Fianzas.La propia Comisin, previa audiencia de la parteinteresada, podr suspender dicha autorizacin hastapor dos aos o revocarla, adems de aplicaramonestaciones y multas a dichos agentes, en lostrminos de esta Ley y del reglamento respectivo. Lasautorizaciones sern para una o varias operaciones oramos; sin embargo, tratndose de la intermediacinen seguros de pensiones derivados de las leyes deseguridad social, las autorizaciones slo se otorgarnpara intermediar estos seguros respecto de una solaInstitucin de Seguros, adems de que se podrnotorgar autorizaciones para el ejercicio de su actividaden otras operaciones o ramos, con diversas

    PERSONA FISICA

    PARA EFECTOS DE ESTA LEY

    PERSONA MORAL

    Las personas fsicas o morales que intervengan en la contratacinde seguros mediante el intercambio de propuestas y aceptaciones,y en el asesoramiento para celebrarlos, para conservarlos omodificarlos, segn la mejor conveniencia de los contratantes.

    Se requerir autorizacin de laComisin Nacional de Seguros yFianzas.( Art. 19 R.A.S.F.)

    sern para una o varias operaciones o ramos;

    Para los seguros de pensionesderivados de las leyes deseguridad social, las

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT15

    en otras operaciones o ramos, con diversasInstituciones.Las autorizaciones tendrn el carcter deintransferibles y podrn otorgarse a las siguientespersonas cuando satisfagan los requisitos que seestablezcan en el reglamento respectivo:a) Personas fsicas vinculadas a las instituciones deseguros por una relacin de trabajo, para desarrollaresta actividad;b) Personas fsicas que se dediquen a esta actividadcon base en contratos mercantiles; yc) Personas morales que se constituyan para operaren esta actividad. Las actividades que realicen los agentes de segurosse sujetarn a las disponsiciones de esta ley y delreglamento respectivo, a las orientaciones de polticageneral que en materia aseguradora y para el debidocumplimiento de lo previsto en el artculo 24 siguiente,seale la Secretara de Hacienda y Crdito Pblico,mediante reglas de carcter general, as como a lainspeccin y vigilancia de la C.N.S.F.. Le sern,adems, aplicable lo dispuesto en el artculo 71 deesta ley.Los agentes de seguros debern reunir los requisitosque exija el reglamento respectivo, pero en ningncaso podr autorizarse a personas que por suposicin o por cualquier circunstancias puedaestablecer coaccin para contratar seguros.

    operaciones o ramos; seguridad social, lasautorizaciones slo se otorgarnpara intermediar estos segurosrespecto de una sola institucinde seguros,

    La propia Comisin, previa audienciade la parte interesada, podrsuspender dicha autorizacin hastapor dos aos o revocarla, adems deaplicar amonestaciones y multas adichos agentes, en los trminos deesta Ley y del reglamento respectivo

    AUTORIZACIONES Tendrn el carcter de intransferibles y podrn otorgarse a:

    A. CONTRATO LABORALvinculadas a las instituciones de segurospor una relacin de trabajo, paradesarrollar esta actividad;

    B. CONTRATO MERCANTILque se dediquen a esta actividad con baseen contratos mercantiles;

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LGISMSARTICULO 24.- Los agentes de seguros

    debern informar de manera amplia ydetallada a quien pretenda contratar unseguro, sobre el alcance real de sucobertura y forma de conservarla o darlapor terminada. Asimismo proporcionarna la Institucin de Seguros, lainformacin autntica que sea de suconocimiento relativa al riesgo cuyacobertura se proponga a fin de que lamisma pueda formar juicio sobre suscaractersticas y fijar conforme a lasnormas respectivas, las condiciones yprimas adecuadas. En el ejercicio de susactividades debern apegarse a lainformacin que proporcionen lasinstituciones para este efecto, as comoa sus tarifas, plizas, endosos, planesde seguros y dems circunstanciastcnicas utilizadas por las institucionesde seguros en trminos de los artculos36, 36- A, 36- B, 36- C y 36- D de estaLey.

    Los agentes de seguros no podrnintervenir en la contratacin de los

    AGENTE DE SEGUROS

    Deber informar a:

    Asimismo proporcionarn a laIinstitucin de Seguros, lainformacin autntica que sea de suconocimiento a fin de que la mismapueda formar juicio sobre suscaractersticas y fijar, lascondiciones y primas adecuadas

    No podrn intervenir en lacontratacin de los seguroscuando su intervencinpueda implicar situacionesde coaccin

    EL AGENTE DEBE INFORMAR AL ASEGURADO Y A LA INSTITUCION SOBRE LOS SIGUIENTE:

    Informar de manera amplia ydetallada sobre el alcancereal de su cobertura y formade conservarla o darla porterminada.1.

    2.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT16

    intervenir en la contratacin de losseguros que determine el Reglamentorespectivo, cuando su intervencinpueda implicar situaciones de coaccin ofalta a las prcticas profesionalesgeneralmente aceptadas en el desarrollode la actividad.

    Los agentes de seguros no proporcionarndatos falsos de las instituciones deseguros, ni detrimentes o adversos encualquier forma para las mismas.

    Articulo 36-b.- Los contratos de segurosen que se formalicen las operaciones deseguros que se ofrezcan al publico engeneral como contratos de adhesin,entendidos como tales aquelloselaborados unilateralmente en formatos,por una Institucin de Seguros y en losque se establezcan los trminos ycondiciones aplicables a la contratacinde un seguro as como los modelos declusulas elaborados para serincorporados mediante endososadicionales a esos contratos, debernser registrados ante la ComisinNacional de Seguros y Fianzas en lostrminos previstos en el articulo 36-d deesta ley.

    condiciones y primas adecuadas2.3.4.

    CONTRATOS DE ADHESION Y NO ADHESION

    CONTRATO

    Aquellos elaborados unilateralmenteen formatos, por una Institucin deSeguros y en los que se establezcanlos trminos y condiciones aplicablesa la contratacin de un seguro ascomo los modelos de clusulaselaborados para ser incorporadosmediante endosos adicionales a esoscontratos

    Aquellos elaborados bilateralmenteen formatos, por una Institucin deSeguros y en los que no seestablezcan los trminos ycondiciones aplicables a lacontratacin de un seguro as comolos modelos de clusulas elaboradospara ser incorporados medianteendosos adicionales a esoscontratos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    REQUISITOS QUE DEBE TENER UNCONTRATO DE SEGUROS

    CARACTERISTICAS DE UN

    Para que el contrato de seguros se lleve a cabo debe cubrir los requisitos de existencia y validez. Para que exista debe haber:

    CONTRATO DE SEGUROS

    CONSENTIMIENTO DE LAS PARTES INVOLUCRADAS

    OBJETO A ASEGURAR

    SOLEMNIDAD DE LAS PARTES

    CAPACIDAD DE LAS PARTES

    AUSENCIA DE VICIOS EN EL CONSENTIMIENTO

    FIN O MOTIVO LICITO

    FORMALIDADES QUE FIJA LA LEY

    CARACTERISTICAS DE UN CONTRATO DE SEGUROS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT17

    CARACTERISTICAS DE UNCONTRATO DE SEGUROS

    SEGUROS

    BILATERAL

    ONEROSO

    ALEATORIO

    PRINCIPAL

    CONSENSUAL

    BUENA FE

    DE ADHESION

    EXISTEN DERECHOS Y OBLIGACIONES PORPARTE DEL CONTRATANTE/ASEGURADO Y LAASEGURADORA

    EXISTE UN DESEMBOLSO ECONOMICO PORPARTE DEL CONTRATANTE/ASEGURADO(PRIMA) Y LA ASEGURADORA (INDEMNIZACION)

    EL CONTRATO CUBRE EVENTOS QUE PUEDENOCURRIR O NO

    NO DEPENDE DE LA EXISTENCIA DE OTROSCONTRATOS PARA QUE SEA VALIDO

    CONSENTIMIENTO DE LAS PARTES EN LAACEPTACION DE LA OFERTA

    LA ASEGURADORA CONFIA EN LAHONESTIDAD, LEALTAD Y PRUDENCIA DELASEGURADO

    LAS CONDICIONES NO ESTAN SUJETAS ADISCUSIN, AUNQUE EXISTEN CONTRATOSQUE NO TIENEN ESTA CARACTERISTICA.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    REGLAMENTO DE AGENTESDE LAS SANCIONES

    R.A.S.F.ARTCULO 27.- Las sancionesadministrativas por las infracciones previstasen las Leyes de Seguros y de Fianzas, eneste Reglamento y en las demsdisposiciones aplicables, sern impuestas porla Comisin y consistirn en:I.- Amonestacin;II.- Multa;III.- Suspensin;IV.- Inhabilitacin, oV.- Revocacin.Las mencionadas sanciones no sern deaplicacin sucesiva, ya que se impondrn enforma independiente, considerando laimportancia de la infraccin y las condicionesdel infractor.Al imponer la sancin que corresponda, laComisin deber or previamente alinteresado a fin de que ofrezca pruebas yalegue lo que a su derecho convenga ytomar en cuenta la importancia de la

    IDENTIFICA LAS INFRACCIONES QUE PUEDE COMETER EL AGENTE

    SANCIONES

    Las mencionadas sanciones no sern de aplicacin sucesiva, ya que se impondrn en forma independiente, considerando la importancia de la infraccin y las condiciones del infractor

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT18

    tomar en cuenta la importancia de lainfraccin, las condiciones del infractor y laconveniencia de evitar prcticas tendientes acontravenir las disposiciones legales, las deeste Reglamento y las de otras disposicionesaplicables.La aplicacin de las sanciones a que serefiere este artculo se har conindependencia de las de orden penal quellegaren a determinar las autoridadescompetentes y de las responsabilidades decarcter civil en que hubiere incurrido elinfractor.

    ARTCULO 28.- Se sancionar conamonestacin escrita a los agentes personasfsicas o apoderados que incumplan con loestablecido en las fracciones I y III del artculo5o. y las fracciones I y II del artculo 7o. deeste Reglamento, segn corresponda. Laimposicin de tres amonestacionesescritas en un perodo de trescientossesenta das naturales, tendr comoconsecuencia la suspensin de losagentes personas fsicas o apoderados, detreinta a sesenta das naturales paradesempear actividades deintermediacin.

    La imposicin de tres amonestaciones escritasen un periodo de trescientos sesenta dasnaturales, tendr como consecuencia:

    LA SUSPENSION DE LOS AGENTES PERSONAS FISICAS O APODERADOS DE 30 A 60 DIAS NATURALES PARA EL DESEMPEO DE SU

    ACTIVIDAD

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    R.A.S.F.ART. 29 Las multas a que se refieren las Leyesde Seguros y Fianzas y dems disposicionesque de ellas emanen, sern impuestasadministrativamente por la Comisin, previaaudiencia de los interesados, tomando comobase el salario mnimo general vigente en elDistrito Federal al momento de cometerse lainfraccin, y se harn efectivas por laSecretara.Las sanciones mencionadas en el prrafoanterior, sern impuestas conforme a lodispuesto en este Reglamento y en lostrminos de las previsiones y multasestablecidas en los artculos 139, fraccionesVII, VIII, X, XI y XXI y 139 Bis antepenltimoprrafo de la Ley de Seguros y 111, fraccionesVI, VII, IX, X, XI y XXI de la Ley de Fianzas.Las multas impuestas debern ser pagadasdentro de los quince das hbiles siguientesa la fecha de su notificacin y cuando elinfractor promueva cualquier medio de defensalegal en contra de la multa que se le hubiereaplicado, en caso de que sta resulteconfirmada, total o parcialmente, su importedeber ser cubierto de inmediato una vez quese notifique al infractor la resolucincorrespondiente. La reincidencia se podrcastigar con multa hasta por el doble de lamxima prevista para la infraccin de que se

    Debern ser pagados dentro de los 15 das hbilessiguientes a la fecha de su notificacin.

    LA REINCIDENCIA SE PODR CASTIGAR CON MULTA HASTA POR EL DOBLE DE LA MXIMA PREVISTA PARA LA INFRACCIN DE QUE SE

    TRATE

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT19

    mxima prevista para la infraccin de que setrate.

    ARTCULO 30.- La Comisin previa audienciade los agentes personas fsicas o de losapoderados, tomando en cuenta, en su caso,los elementos que hubieren aportado lasInstituciones, as como las dems personasafectadas, suspender a los agentespersonas fsicas o apoderados durante unperodo de treinta das naturales a dos aos,para desempear actividades deIntermediacin, cuando:. I.- Declaren falsamente cualquier dato de losconsignados en la solicitud presentada paraobtener la autorizacin o refrendo para actuarcomo agente persona fsica o apoderado;II.- Requieran del solicitante, contratante,asegurado, fiado, obligado solidario obeneficiario, cualquier prestacin que no seencuentre legalmente justificada, aun cuandono se llegue a recibir;III.- Omitan informar por escrito a losproponentes conforme a lo dispuesto por losartculos 5o. y 7o. de este Reglamento, segncorresponda;IV.- Incumplan con lo establecido en alguna delas fracciones II, IV o V, del artculo 5o., o III aVIII, del artculo 7o., de este Reglamento;V.- Acten en perjuicio de los solicitantes,contratantes, asegurados, fiados o beneficiariosal obtener de ellos la cancelacin, terminacino modificacin de una pliza que impliqueprdida o reduccin de derechos, ocontraprestaciones mayores;

    CUNDO PODRA LA COMISION SUSPENDER A UN AGENTE?

    Cuando habiendo tomado en cuenta los elementos que hubierenaportado las Instituciones, as como las dems personasafectadas, el agente:

    DECLARE FALSAMENTE EN SU SOLICITUD PARA OBTENER AUTORIZACIONREQUIERA DEL SOLICITANTE CUALQUIER PRESTACION NO LEGALOMITA INFORMAR AL CLIENTE TODOS LOS DATOS SOBRE SU SEGURO Y SU AGENTEACTUE EN PERJUICIO DEL SOLICITANTEPROPORCIONE DATOS FALSOS SOBRE LA PERSONA SOLICITANTE DEL SEGURO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    VI.- Proporcionen datos falsos a lasInstituciones sobre la persona del solicitante,contratante, asegurado, fiado, obligadosolidario o beneficiario, o desvirten lanaturaleza del riesgo o responsabilidad que seproponga asegurar o afianzar o se hayaasumido, yVII.- Oculten a las Instituciones la existencia dehechos cuyo conocimiento habra impedido lacelebracin del contrato de seguro o de fianza,segn sea el caso, o hubiere cambiado lascondiciones de la contratacin respectiva.Declarada la suspensin, el agente personafsica o apoderado, deber entregar lacdula a la Comisin, la cual la devolver alinteresado una vez concluido el perodo desuspensin.La declaracin de suspensin impedir alagente persona fsica o apoderado, interveniren la intermediacin de contratos de seguros ofianzas, segn sea el caso.

    ARTCULO 31.- La Comisin, previa audienciade los agentes personas fsicas o de losapoderados, tomando en cuenta, en su caso,los elementos que hubieren aportado las

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    En caso de que el agente persona fsica o apoderado no entregue primas por primera

    ocasin y no se afecte al proponente o se resarza el dao, se suspender su autorizacin

    de treinta a sesenta das naturales para desempear

    actividades de intermediacin

    CCCC

    CCCCGGGGCTCTCTCTTTTT20

    los elementos que hubieren aportado lasInstituciones, as como las dems personasafectadas, revocar la autorizacin otorgada alos agentes personas fsicas o apoderadospara desempear actividades deintermediacin, cuando:I.- Dejen de entregar a las Instituciones o a losagentes personas morales, en su caso, lasprimas cobradas o los documentos y bienesque reciban por su cuenta conforme a lodispuesto por el artculo 24 de esteReglamento.En caso de que el agente persona fsica oapoderado incurra en esta infraccin porprimera ocasin y no se afecte alproponente o se resarza el dao, sesuspender su autorizacin de treinta asesenta das naturales para desempearactividades de intermediacin;II.- Acten dentro del territorio nacional en lacelebracin de contratos de seguros directos ode fianzas, como representante o intermediariode cualquier empresa no autorizada parafuncionar en el pas como institucin deseguros o de fianzas, de acuerdo con loestablecido por las Leyes de Seguros y deFianzas;

    NO ENTREGUEN PRIMAS A LAS INSTITUCIONESCELEBREN CONTRATOS CON INSTITUCIONES NO AUTORIZADASNO SATISFAGA LOS REQUERIMIENTOS DEL REGLAMENTOACTUE COMO AGENTE ENCONTRANDOSE SUSPENDIDOCOMETA 5 INFRACCIONES SEALADAS EN EL ART. 139 BIS DE LA LEY DE SEGUROS

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    III.- Dejen de satisfacer los requisitos queeste Reglamento exige para el otorgamientode la autorizacin para actuar como agentepersona fsica o apoderado o ubicarse enalguno de los impedimentos a que serefieren los supuestos establecidos en elartculo 13 de este Reglamento;IV.- Acten como agente persona fsica oapoderado, encontrndose suspendido porsancin aplicada por autoridad competente;V.- Entren en concurso mercantil oquiebra, salvo que el procedimientorespectivo termine por rehabilitacin, yVI.- Cometan cinco infracciones por losconceptos sealados en la fraccin II, delartculo 139 Bis de la Ley de Seguros,durante un lapso de doscientos dasnaturales.La revocacin surtir efecto respecto atodas las autorizaciones otorgadas alinfractor, para ejercer actividades deintermediacin.Declarada la revocacin, la personasancionada deber entregar la cdula a laComisin, la cual proceder a sucancelacin conforme a lo establecido en elartculo 37 de este Reglamento, adems deque no podr continuar realizando

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT21

    que no podr continuar realizandoactividades de intermediacin.

    ARTCULO 32.- La Comisin, previaaudiencia del agente persona moral,tomando en cuenta, en su caso, loselementos que hubieren aportado lasInstituciones, as como las dems personasafectadas, revocar la autorizacin otorgadaa los agentes personas morales paradesempear actividades de intermediacin,cuando:I.- Dejen de entregar a las Instituciones lasprimas ingresadas o los documentos ybienes que reciban por su cuenta, conformea lo dispuesto por el artculo 24 de esteReglamento.En caso de que el agente persona moralincurra en esta infraccin por primeraocasin y no se afecte al proponente o seresarza el dao, se suspender laautorizacin de treinta a sesenta dasnaturales para desempear actividadesde intermediacin;

    NO ENTREGUEN PRIMAS A LAS INSTITUCIONESCELEBREN CONTRATOS DE SEGUROS Y/O DE FIANZAS CON INSTITUCIONES NO AUTORIZADASACTUE COMO PERSONA MORAL ENCONTRANDOSE SUSPENDIDOENTRE EN DISOLUCION O LIQUIDACIONCOMETA 5 INFRACCIONES SEALADAS EN EL ART. 139 BIS DE LA LEY DE SEGUROS. TRES DE SUS APODERADOS HAYAN SIDO REVOCADOS DE SU AUTORIZACION EN UN PERIODO DE 300 DIAS NATURALES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    III.- Acten como agente persona moral,encontrndose suspendido por sancinaplicada por autoridad . competente;IV.- Entren en disolucin, liquidacin,concurso mercantil o quiebra, salvo que enel procedimiento de quiebra se determinela rehabilitacin;V.- Cometan cinco infracciones por losconceptos sealados en la fraccin II,del artculo 139 Bis de la Ley deSeguros, durante un lapso dedoscientos das naturales, yVI.- Tres de sus apoderados hayan sidosancionados con la revocacin de suautorizacin para ejercer actividades deintermediacin, en un periodo detrescientos das naturales.Declarada la revocacin, la personamoral no podr continuar realizandoactividades de intermediacin, ademsde que dicha revocacin se publicaren el Diario Oficial de la Federacin yse ordenar su inscripcin en elRegistro Pblico de Comercio.

    ARTCULO 33.- Los agentes yapoderados de Seguros que cometanalguna de las infracciones previstas en la

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT22

    alguna de las infracciones previstas en lafraccin II, del artculo 139 Bis de la Leyde Seguros, en forma individual oconjuntamente con las Aseguradoras,sern sancionados con inhabilitacin paraintermediar, en cualquier tiempo, con laspersonas que conforme a las Reglas deOperacin para los Seguros dePensiones, derivados de las Leyes deSeguridad Social, aparezcan relacionadasen el listado de un da de la base deprospectacin que distribuya el InstitutoMexicano del Seguro Social. Estainhabilitacin no ser menor de dos nimayor a cinco das de los listadoscorrespondientes a cada uno de los dasde la sancin.

    Los agentes y apoderados de seguros que cometanalguna de las infracciones previstas en la fraccin IIdel art. 139 de la Ley de Seguros

    LA INHABILITACION NO SERA MENOR DE DOS NI MAYOR DE CINCO DIAS

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTCULO 34.- La determinacin de lassanciones a que se refiere este Captulo, sehar conforme al siguiente procedimiento:I.- Se iniciar de oficio o por quejapresentada por cualquier persona afectadaque tenga inters jurdico respecto de lainfraccin;II.- Las quejas que se formulen debernestar apoyadas en pruebas documentales oelementos probatorios suficientes, quehagan probable la infraccin del agente oapoderado.En caso de que la queja no cumpla con lodispuesto en el prrafo anterior, sedictar su sobreseimiento por falta deelementos;III.- Se notificar al agente o apoderado elinicio del procedimiento, mediante oficio dela Comisin y, en su caso, copia de la quejay sus anexos, para que en un trmino dediez das hbiles contado a partir de lafecha de notificacin, conteste por escritosobre los hechos que se le imputan y rindalas pruebas correspondientes. Lacontestacin deber referirse a todos y cadauno de los hechos afirmndolos,negndolos, expresando los que ignore porno ser propios o refirindolos como crea quetuvieron lugar.

    1. SE INICIARA DE OFICIO O POR QUEJAS2. DEBERAN ESTAR APOYADAS EN PRUEBAS

    DOCUMENTALES Y PROBATORIAS3. SE NOTIFICARA AL AGENTE MEDIANTE

    OFICIO DE LA COMISION4. SI EL AGENTE O APODERADO OMITE

    FORMULAR LA CONTESTACION PRECLUIRASU DERECHO.

    5. TRANSCURRIDO EL TERMINO, SEPROCEDERA AL DESAHOGO DE PRUEBAS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT23

    tuvieron lugar.Se presumirn aceptados los hechos sobrelos cuales el agente o apoderado nosuscitare explcitamente controversia, salvoprueba en contrario;IV.- En el caso de que el agente oapoderado omita formular la contestacin aque se refiere la fraccin anterior, dentro deltrmino establecido en la misma, precluirsu derecho, sin que se requiera declaracinal respecto y continuar el procedimiento;V.- Transcurrido el trmino establecido en lafraccin III, de este artculo, se proceder aldesahogo de las pruebas, que en su casose hayan aportado y al anlisis delexpediente respectivo.La Comisin tendr la facultad de allegarsetodos los elementos de juicio que estimenecesarios para conocer con precisin loshechos que hayan motivado elprocedimiento. Para tal efecto, podrvalerse de cualquier persona o documento,ya sea que pertenezca al quejoso, alprobable infractor o a persona ajena alprocedimiento, sin ms limitaciones que lasde que las pruebas no estn prohibidas porla ley y tengan relacin inmediata con loshechos controvertidos.

    6. SE RESOLVERA SOBRE LA INEXISTENCIA DELA INFRACCION O IMPONIENDO LA SANCIONCORRESPONDIENTE.

    7. SI DE LA CONTESTACION SE ADVIERTENNUEVOS ELEMENTOS SE ACORDARA LAINICIACION DE OTRO PROCEDIMIENTO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Desahogadas las pruebas y con loselementos que, en su caso, se hubieraallegado la Comisin, se resolver sobrela inexistencia de la infraccin oimponiendo al agente o apoderado lasancin correspondiente, y se le notificarla resolucin al interesado, yVI.- Si de la contestacin se adviertennuevos elementos que impliquen otrasinfracciones a cargo del agente oapoderado o de otras personas, seacordar la iniciacin de otroprocedimiento y, en su caso, podrdisponerse previamente la prctica deinvestigaciones.ARTCULO 35.- Las notificaciones a quese refiere este Captulo, se harn en elltimo domicilio comunicado a la Comisin,excepto que se hubiere designado unoespecfico para esos efectos, conforme alo establecido en las Leyes de Seguros yFianzas.Tratndose de los agentes a que serefieren los artculos 1o., fraccin VIII,inciso a) y 20 de este Reglamento, ascomo de los apoderados, dichasnotificaciones se harn del conocimientode la Institucin o del agente personamoral, segn corresponda.

    LAS NOTIFICACIONES SE HARAN EN EL ULTIMO DOMICILIO COMUNICADO A LA COMISION, EXCEPTO QUE SE HUBIERA

    DESIGNADO UNO ESPECIFICO PARA ESOS EFECTOS.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT24

    moral, segn corresponda.ARTCULO 36.- Los agentes oapoderados podrn recurrir por escrito lassanciones que les sean impuestas, confundamento y de conformidad, segncorresponda, con los artculos 108,fraccin III, de la Ley de Seguros y 68,fraccin V, de la Ley de Fianzas.

    ARTCULO 37.- La Comisin proceder ala cancelacin de la cdula, cuando laautorizacin correspondiente se extingapor motivo de:I.- Revocacin de la autorizacin;II.- Muerte;III.- Renuncia a ejercer las actividades deintermediacin;IV.- Terminacin de la relacin laboral enel caso de agentes personas fsicasvinculadas a las instituciones por unarelacin de trabajo;V.- Ser declarado en estado deinterdiccin;VI.- Disolucin y liquidacin, concursomercantil o quiebra de los agentespersonas morales, yVII.- Fusin, en cuyo supuesto secancelar la de la fusionada.

    REVOCACION DE LA AUTORIZACIONMUERTERENUNCIA A EJERCER LAS ACTIVIDADES DE INTERMEDIACIONTERMINACION DE LA RELACION LABORAL EN EL CASO DEAGENTES PERSONAS FISICAS VINCULADAS A LASINSTITUCIONES POR UNA RELACION DE TRABAJOSER DECLARADO EN ESTADO DE INTERDICCIONDISOLUCION Y LIQUIDACION, CONCURSO MERCANTIL OQUIEBRA DE AGENTES PERSONAS MORALESFUSION EN CUYO SUPUESTO SE CANCELARA LA DE LAFUSIONADA.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 139.- Las sanciones correspondientes a lasinfracciones previstas en esta Ley, as como a lasdisposiciones que de ella emanen, sern impuestasadministrativamente por la Comisin Nacional de Segurosy Fianzas de acuerdo a lo siguiente:.....................

    VII. -Multa de 100 a 8000 das de salario a la Institucin deseguros, a sus empleados o a los agentes de seguros queen alguna forma ofrezcan o hagan descuentos o reduccinde primas u otorguen algn otro beneficio no estipulado enla pliza, como aliciente para tomar o conservar uncontrato de seguro;VIII. - Multa de 1000 a 8000 de salario,independientemente de las responsabilidades civiles openales en que incurran, a los Agentes de Seguros ofuncionarios o empleados de una institucin o sociedadmutualista de seguros, que proporcionen datos falsos odetrimentes adversos, respecto a las instituciones osociedades mutualistas de seguros o en cualquier formahicieren competencia desleal a instituciones o sociedadesmutualistas de seguros;................

    X. -Multa de 1000 a 5000 das de salario, a lasInstituciones o sociedades mutualistas de seguros uoficinas de representacin de entidades reaseguradorasdel extranjero, a los agentes de seguros y a losintermediarios de reaseguro, por la propaganda opublicacin que hagan en contravencin a lo dispuesto porel artculo 71 de esta Ley;XI. - Multa de 500 a 2500 das de salario, a la persona queacte como agente de seguros, intermediario dereaseguro, ajustador de seguros, representante de una

    Las sanciones correspondientes sernimpuestas administrativamente por laComisin Nacional de Seguros y Fianzas

    Estas sanciones podrn ser a lasInstituciones de seguros, a susempleados o a los agentes

    Independientemente de las responsabilidadesciviles o penales en que incurran los agentes queproporcione datos falsos, o hicieren competenciadesleal a las Instituciones de seguros tambinsern multados

    Tambin se multarn a las Instituciones de

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT25

    reaseguro, ajustador de seguros, representante de unaentidad reaseguradora del exterior o sociedad a que serefiere el artculo 69 Bis de esta Ley, que opere sin laautorizacin correspondiente.Multa de 500 a 2500 das de salario, al agente de seguros,intermediario de reaseguro, ajustador de seguros,representante de una entidad reaseguradora del exterior osociedad a que se refiere el artculo 69 Bis de esta Ley,que al amparo de su autorizacin permitan que un tercerorealice las actividades que les estn reservadas..........

    XXI- Multa de 200 a 5000 das de salario, si lasdisposiciones violadas de esta Ley, as como a las que deella emanen, no tienen sancin especialmente sealadaen la misma.

    Si se tratar de una institucin o sociedad mutualistade seguros o un agente de seguros o de reaseguropersona moral, la multa se podr imponer tanto adicha institucin o sociedad mutualista de seguros oal agente de seguros o de reaseguro persona moral,como cada uno de los consejeros, directores,administradores, comisarios, funcionarios,apoderados, agentes o empleados que resultenautores o responsables de la infraccin. Entre otrasARTICULO 143 . Se impondr pena de prisin de unoa quince aos y multa de cinco mil a cincuenta mildas de salario a los consejeros, comisarios,directores, funcionarios o empleados de unaInstitucin o Sociedad Mutualista de Seguros.

    Tambin se multarn a las Instituciones de Seguros cuando exista contravencin respecto a la propaganda o publicacin

    Al agente de seguros, ajustador, intermediario de reaseguros que oper sin la autorizacin correspondiente se hace acreedor a multas

    Se harn acreedores a multas laspersonas que violen lasdisposiciones de esta ley.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LGISMSARTICULO 139 BISEn adicin a lo previsto en el presente Captulo, a lasInstituciones de Seguros autorizadas en los trminos de estaley, para operar el artculo a que se refiere el captulo VIIfraccin segunda de la presente ley, La C.N.S.F., les aplicaradministrativamente las sanciones que a continuacin seindican, cuando de manera directa, conjuntamente con susagentes o por interpsita persona, cometan las infraccionesque respecto de cada una de ellas se sealan:.................

    Las sanciones correspondientes sernimpuestas administrativamente por laComisin Nacional de Seguros y Fianzas

    Los Agentes se harn acreedores a multas, que pueden llegar hasta5,000 das de salario mnimo, cuando comentan las siguientesinfracciones y delitos.

    - Ofrezcan o hagan descuentos o reduccin de primas u otorguenalgn otro beneficio no estipulado en la pliza (Fracc. VII) 100 a 8000 D.S.M.

    -Proporcione datos falsos, detrimentes o adversos respecto deCompaas o Mutualistas de Seguros (Fracc. VII) 100 a 8000D.S.M.

    ARTICULO 142.- Se impondr pena de prisinde uno a quince aos y multa de quinientos a milquinientos das de salario:I.- Al agente o al mdico que dolosamente o con nimo delucrar, oculte a la empresa aseguradora la existencia dehechos cuyo conocimiento habra impedido la celebracin deun contrato de seguro; yII.- Al mdico que suscriba un examen destinado a servir debase para la contratacin de un seguro, con una persona oentidad no facultada para funcionar en los trminos de estaLey como institucin o sociedad mutualista de seguros,cuando lo haga a solicitud o por encargo de dicha persona oentidad.

    Se impondr pena de prisin al agente omdico que dolosamente que con nimo delucrar, oculte a la empresa la existencia dehechos cuyo conocimiento habra impedidola celebracin de un contrato de seguros

    ARTICULO 41. - Las Instituciones de Seguros slopodrn pagar comisiones y cualquier otra

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT26

    Slo podrn pagarcomisiones a agentes deseguros, sobre las primasque efectivamente hayaningresado a la institucin.

    slo podrn cobrar primascontra el recibo oficialexpedido por lasinstituciones

    Art. 41 Art. 42

    podrn pagar comisiones y cualquier otracompensacin por la contratacin de seguros aagentes de seguros, sobre las primas queefectivamente hayan ingresado a la institucin.Las Instituciones de Seguros podrn tomando encuenta las condiciones de contratacin ocaractersticas de los riesgos que cubran los seguros,aplicar total o parcialmente las comisionesestablecidas por los agentes en beneficio delasegurado o contratante, en su caso, procurando entodo momento el desarrollo de planes de seguros. Eneste supuesto, las Instituciones debern especificaren la pliza el monto de la reduccin de primas, quecorresponda a la aplicacin total o parcial de lascitadas comisiones.

    ARTICULO 42.- Los agentes de seguros slopodrn cobrar primas contra el recibo oficial expedidopor las instituciones. Las primas as cobradas seentendern recibidas directamente por lasaseguradoras.Cuando el agente de seguros, vinculado a una Institucion deSeguros por una relacin laboral o un contrato mercantil o porcuyo conducto la propia Institucin haya aceptado lacontratacin de seguros, entregue a una persona recibos odocumentos oficiales para la salicitud o contratacin deseguros, obligar a la Institucin en los trminos que se hayanestablecido en dichos terminos.Los recibos oficiales entregados en los trminos del prrafoanterior por un agente, amparando un contrato de seguros enel que se indentifquen los riesgos cubiertos, obligarigualmente a la Institucin Aseguradora.Solo podrn celebrar contratos a nombre y por cuenta de unaInstitucin Aseguradora, el agente de Seguros designadoexpresamente por esta para actuar como su apoderado.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.3 LEY SOBRE EL CONTRATO DE SEGUROS

    LEY SOBRE EL CONTRATO DESEGUROS

    TITULOS QUE CONFORMAN LA LEYSOBRE EL CONTRATO DE SEGUROS I. PRELIMINARES

    II. SEGUROS DE DAOSIII. SEGUROS DE PERSONAS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    FIGURAS QUE INTERVIENEN ELEMENTOS QUE LO CONFORMAN

    Institucin AseguradoraEl intermediarioEl contratante

    SolicitudPlizaEndosos

    CCCC

    CCCCGGGGCTCTCTCTTTTT27

    IV. DISPOSICIONES FINALES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.3 LEY SOBRE EL CONTRATO DE SEGUROSCONTRATO DE SEGUROSPRIMA, RIESGO REALIZACION DEL SINIESTROINTERES ASEGURABLE (VIDA Y DAOS)LA POLIZA

    ARTICULO 1.- Por el contrato de seguro, laempresa aseguradora se obliga, medianteuna prima, a resarcir un dao o a pagar unasuma de dinero al verificarse la eventualidadprevista en el contrato.

    ARTICULO 2.- Las empresas de segurosslo podrn organizarse y funcionar deconformidad con la Ley General deInstituciones y Sociedades Mutualistas deSeguros.ARTICULO 3.- El seguro martimo se rigepor las disposiciones relativas del Cdigo deComercio y por la presente ley en lo quesea compatible con ellas.

    TITULO ICAPITULO I DEFINICION Y CELEBRACION DEL CONTRATO

    Qu se entiende por Contrato de Seguro?

    En qu instrumento legal basan su organizacin y funcionamiento las Empresas de Seguros?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT28

    ARTICULO 4.- Los seguros socialesquedarn sujetos a las leyes y reglamentossobre la materia.ARTICULO 5.- Las ofertas de celebracin,prrroga, modificacin o restablecimiento deun contrato suspendido, obligarn alproponente durante el trmino de quincedas, o el de treinta cuando fuere necesariopracticar examen mdico, si no se fija unplazo menor para la aceptacin.ARTICULO 6.- Se considerarn aceptadaslas ofertas de prrroga, modificacin orestablecimiento de un contrato suspendido,hechas en carta certificada con acuse derecibo, si la empresa aseguradora nocontesta dentro del plazo de quince das,contados desde el siguiente al de larecepcin de la oferta, pero sujetas a lacondicin suspensiva de la aprobacin de laSecretara de Hacienda y Crdito Pblico.La disposicin contenida en este artculono es aplicable a las ofertas de aumentarla suma asegurada y en ningn caso alseguro de personas.

    En que plazo mximo el proponente debe presentar un examen mdico requerido por la Institucin?

    Para que sea aceptada una oferta de prrroga, modificacin o restablecimiento como debe ser presentada?

    Qu plazo tiene la Institucin para contestar ?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 7.- Las condiciones generalesdel seguro debern figurar en el mismoformulario de ofertas suministrado por laEmpresa Aseguradora, o bien remitirse alproponente para que ste las incluya en laoferta del contrato que ha de firmar yentregar a la empresa. El proponente noestar obligado por su oferta si la empresano cumple con esta disposicin. En todocaso, las declaraciones firmadas por elasegurado sern la base para el contrato, sila empresa le comunica su aceptacindentro de los plazos que fija el artculo 6 dela presente ley.

    ARTICULO 8.- El proponente estarobligado a declarar por escrito a la empresaaseguradora, de acuerdo con el cuestionariorelativo, todos los hechos importantes parala apreciacin del riesgo que puedan influiren las condiciones convenidas, tales comolos conozca o deba conocer en el momentode la celebracin del contrato.ARTICULO 9.- Si el contrato se celebra porun representante del asegurado, debern

    Cundo deben entregarse las condiciones generales de la pliza al cliente?

    Cundo una persona solicita un seguro, a que esta obligada de acuerdo al Artculo No. 8 de la L.S.C.S.?

    Cundo el contrato de seguros se hace por un tercero Quin debe

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT29

    un representante del asegurado, deberndeclararse todos los hechos importantesque sean o deban ser conocidos delrepresentante y del representado.ARTICULO 10.- Cuando se proponga unseguro por cuenta de otro, el proponentedeber declarar todos los hechosimportantes que sean o deban serconocidos del tercero asegurado o de suintermediario.ARTICULO 11.- El seguro podr contratarsepor cuenta propia o por cuenta de otro, cono sin la designacin de la persona deltercero asegurado. En caso de duda, sepresumir que el contratante obra porcuenta propia.

    El seguro puede ser contratado por medio de otra persona?

    Cundo el contrato de seguros se hace por un tercero Quin debe proporcionar la informacin para apreciar el riesgo.?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 12.- El seguro por cuenta de un terceroobliga a la empresa aseguradora, aun en el casode que el tercero asegurado ratifique el contratodespus del siniestro.

    ARTICULO 13.- Salvo pacto expreso en contrariocontenido en el contrato de mandato o en lapliza, el mandatario que contrate un seguro anombre de su mandante, podr reclamar el pagode la cantidad asegurada.

    ARTICULO 14.- Los agentes que sean autorizadospor una empresa de seguros para que elloscelebren contratos, podrn recibir las ofertas,rechazar las declaraciones escritas de losproponentes, cobrar las primas vencidas,extender recibos, as como proceder a lacomprobacin de los siniestros que se realicen.

    ARTICULO 15.- Respecto al asegurado, se reputarque el agente podr realizar todos los actos quepor costumbre constituyan las funciones de unagente de su categora y los que de hechoefecte habitualmente con autorizacin de laempresa.

    ARTICULO 16.- En todo caso, el agente necesitarautorizacin especial para modificar las

    Qu funciones podrn desempear los agentes autorizados por una empresa de seguros.?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT30

    condiciones generales de las plizas, ya sea enprovecho o en perjuicio del asegurado.

    ARTICULO 17.- La renovacin tcita del contrato enningn caso exceder de un ao.

    ARTICULO 18.- Aun cuando la empresa se reasegurecontra los riesgos que hubiere asegurado, seguirsiendo la nica responsable respecto alasegurado.

    CAPITULO II LA POLIZAARTICULO 21.- El contrato de seguros:I. Se perfecciona desde el momento en que el

    proponente tuviere conocimiento de la aceptacinde la oferta. En los seguros mutuos sernecesario adems, cumplir con los requisitos quela ley o los estatutos de la empresa establezcanpara la admisin de nuevos socios.

    II. No pueden sujetarse a la condicin suspensiva dela entrega de la pliza o de cualquier otrodocumento en que conste la aceptacin, nitampoco a la condicin del pago de la prima; y

    III. Puede celebrarse sujeto a plazo, a cuyovencimiento se iniciar su eficacia para laspartes, pero tratandose de seguro de vida el plazoque se fije no podr exceder de treinta das apartir del examen mdico si este fuere necesario,y si no lo fuera a partir de la oferta.

    En el reaseguro Quin es el responsable ante el asegurado directo.?

    La renovacin tcita No podr ser mayor a que plazo?

    En que momento se perfecciona el contrato?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 31.- El contratante del seguro estarobligado a pagar la prima en su domicilio, si no hayestipulacin expresa en contrario.ARTICULO 32.- En el seguro por cuenta de tercero, laempresa aseguradora podr reclamar del aseguradoel pago de la prima cuando el contratante que obtuvola pliza resulte insolvente.ARTICULO 33.- La empresa aseguradora tendr elderecho de compensar las primas y los prstamos

    TITULO ICAPITULO III LA PRIMA

    De acuerdo a lo que marca la ley en donde debe pagar las primas el asegurado.?

    Si al momento del siniestro, la pliza tiene adeudos de primas o prestamos quin y como los pagan?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    ARTICULO 25.- Si el contenido de la pliza o susmodificaciones no concordaren con la oferta elasegurado podr pedir la rectificacincorrespondiente dentro de los treinta das que siganal da en que reciba la pliza, transcurrido este plazose considerarn aceptadas las estipulaciones de lapliza o de sus modificaciones.ARTICULO 26.- El artculo anterior deber incertarsetextualmente en la pliza.

    En que plazo el asegurado puede solicitar una rectificacin a la pliza?

    CCCC

    CCCCGGGGCTCTCTCTTTTT31

    derecho de compensar las primas y los prstamossobre plizas que se le adeuden, con la prestacindebida al beneficiario.

    ARTICULO 34.- Salvo pacto en contrario, la primavencer en el momento de la celebracin del contrato,por lo que se refiere al primer perodo del seguro;entendindose por perodo del seguro el lapso para elcual resulte calculada la unidad de la prima. En casode duda, se entender que el perodo del seguro esde un ao.ARTICULO 35.- La empresa aseguradora no podreludir la responsabilidad por la realizacin de riesgo,por medio de clusulas en que convenga que elseguro no entrar en vigor sino despus del pago dela primera prima o fraccin de ella.ARTICULO 36.- En caso de duda, las primasulteriores a la del primer perodo del seguro seentendern vencidas al comienzo y no al fin de cadanuevo perodo.ARTICULO 37.- En los seguros de vida, en los deaccidentes y enfermedades, as como en los dedaos, la prima podr ser fraccionada enparcialidades que correspondan a perodos de igualduracin. Si el asegurado optare por cubrir la primaen parcialidades, cada una de stas vencer alcomienzo del perodo que comprenda.

    prestamos quin y como los pagan?

    cundo se considera vencida la prima?

    A partir de cuando entra en vigor el seguro?

    cundo vencen las primas?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 38.- En caso de que seconvenga el pago de la prima en formafraccionada, cada uno de los perodos deigual duracin a que se refiere el artculoanterior no podrn ser inferiores a un mes.

    ARTICULO 39.- En los seguros por un soloviaje, tratndose de transporte martimo,terrestre o areo y de accidentespersonales, as como en los seguros deriesgos profesionales, no se podr convenirel pago fraccionado de la prima.ARTICULO 40.- Si no hubiese sido pagadala prima o la primera fraccin de ella, en loscasos de pago en parcialidades, dentro deltrmino convenido, el cual no podr serinferior a tres das ni mayor a treinta dasnaturales siguientes a la fecha de suvencimiento, los efectos del contratocesarn automticamente a las doce horasdel ltimo da de ese plazo. En caso de que

    TITULO ICAPITULO IIILA PRIMA

    La prima fraccionada a que perodo no podr ser inferior?

    Qu perodo mximo tiene el asegurado para cubrir las primas?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    En que tipo de seguros la prima no pueda ser fraccionada?

    CCCC

    CCCCGGGGCTCTCTCTTTTT32

    del ltimo da de ese plazo. En caso de queno se haya convenido el trmino, se aplicarel mayor previsto en este artculo.ARTICULO 41.- Ser nulo cualquierconvenio que pretenda privar de sus efectosa las disposiciones del artculo anterior.ARTICULO 42.- La empresa aseguradorano podr rehusar el pago de la primaofrecida por los acreedores privilegiados,hipotecarios o prendarios, tercerosasegurados, beneficiarios o por cualquierotro que tenga inters en la continuacindel seguro.ARTICULO 43.- Si la prima se ha fijado enconsideracin a determinados hechos queagraven el riesgo y estos hechosdesaparecen o pierden su importancia en elcurso del seguro, el asegurado tendrderecho a exigir que en los perodosulteriores se reduzca la prima, conforme a latarifa respectiva y si as se convino en lapliza, la devolucin de la partecorrespondiente por el perodo en curso.ARTICULO 44.- Salvo estipulacin encontrario, la prima convenida para elperodo en curso, se adeudar en sutotalidad aun cuando la empresaaseguradora no haya cubierto el riesgo sinodurante una parte de ese tiempo.

    A que tiene derecho el asegurado, si los hechos que agravan el riesgo asegurado desaparecen?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 45.- El contrato de seguro sernulo si en el momento de su celebracin elriesgo hubiere desaparecido o el siniestrose hubiere ya realizado. Sin embargo, losefectos del contrato podrn hacerseretroactivos por convenio expreso de laspartes contratantes. En caso deretroactividad, la empresa aseguradora queconozca la inexistencia del riesgo, no tendrderecho a las primas ni al reembolso de susgastos; el contratante que conozca esacircunstancia perder el derecho a larestitucin de las primas y estar obligado alpago de losgastos.ARTICULO 46.- Si el riesgo deja de existirdespus de la celebracin del contrato, stese resolver de pleno derecho y la prima sedeber nicamente por el ao en curso, ano ser que los efectos del seguro debancomenzar en un momento posterior a lacelebracin del contrato y el riesgodesapareciere en el intervalo, en cuyo casola empresa slo podr exigir el reembolso

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    Cundo se considera nulo el contrato?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT33

    la empresa slo podr exigir el reembolsode los gastos.ARTICULO 47.- Cualquiera omisin oinexacta declaracin de los hechos a que serefieren los artculos 8o, 9o y 10 de lapresente ley, facultar a la empresaaseguradora para considerar rescindido depleno derecho el contrato, aunque no hayainfluido en la realizacin del siniestro.ARTICULO 48 .- La empresa aseguradoracomunicar en forma autntica al aseguradoo a sus beneficiarios, la rescisin delcontrato dentro de los treinta das naturalessiguientes a la fecha en que la propiaempresa conozca la omisin o inexactadeclaracin.

    Cundo el asegurado incurra en omisin o inexacta declaracin qu facultad adquiera la compaa?

    En que tiempo la aseguradora le deber notificar al asegurado la rescisin del contrato por omisin o Inexacta declaracin?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 49.- Cuando el contrato deseguro comprenda varias cosas o variaspersonas y la omisin o inexactadeclaracin no se refieran sino a algunas deesas cosas, o de esas personas, el seguroquedar en vigor para las otras, si secomprueba que la empresa aseguradora lashabra asegurado solas en las mismascondiciones.ARTICULO 50.- A pesar de la omisin oinexacta declaracin de los hechos, laempresa aseguradora no podr rescindir elcontrato en los siguientes casos:I. - Si la empresa provoc la omisin oinexacta declaracin;II. - Si la empresa conoca o deba conocerel hecho que no ha sido declarado;III. - Si la empresa conoca o deba conocerexactamente el hecho que ha sidoinexactamente declarado;

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    Cundo la empresa no puede rescindir el contrato a pesar de la omisin o inexacta declaracin de los hechos?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT34

    IV. - Si la empresa renunci al derecho derescisin del contrato por esa causa;V. - Si el declarante no contesta una de lascuestiones propuestas y sin embargo laempresa celebra el contrato. Esta regla nose aplicar si de conformidad con las otrasindicaciones del declarante, la cuestindebe considerarse contestada en unsentido determinado y esta contestacinaparece como una omisin o inexactadeclaracin de los hechos.ARTICULO 51.- En caso de rescisinunilateral del contrato por las causas a quese refiere el artculo 47 de esta ley, laEmpresa Aseguradora conservar suderecho a la prima por el perodo del seguroen curso en el momento de la rescisin;pero si sta tiene lugar antes de que elriesgo haya comenzado a correr para laempresa, el derecho se reducir alreembolso de los gastos efectuados.Si la prima se hubiere pagadoanticipadamente por varios perodos delseguro, la empresa restituir las tres cuartaspartes de las primas correspondientes a losperodos futuros del seguro.

    En caso de resicion del contrato por omision o inexacta declaracion Cundo la compaa tendr que devolver primas al asegurado ?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 52.- El asegurado debercomunicar a la empresa aseguradora lasagravaciones esenciales que tenga el riesgodurante el curso del seguro, dentro de lasveinticuatro horas siguientes al momento enque las conozca. Si el asegurado omitiereel aviso o si l provoca una agravacinesencial del riesgo, cesarn de plenoderecho las obligaciones de la empresa enlo sucesivo.ARTICULO 53.- Para los efectos del artculoanterior se presumir siempre:I. - Que la agravacin es esencial, cuandose refiera a un hecho importante para laapreciacin de un riesgo de tal suerte que laempresa habra contratado en condicionesdiversas si al celebrar el contrato hubiereconocido una agravacin anloga;II. - Que el asegurado conoce o debeconocer toda agravacin que emane deactos u omisiones de sus inquilinos,

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    En caso de agravacin esencial del riesgo A que esta obligado el asegurado?

    Cundo se considera que la agravacin del riesgo es esencial?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT35

    actos u omisiones de sus inquilinos,cnyuge, descendientes o cualquiera otrapersona que, con el consentimiento delasegurado, habite el edificio o tenga en supoder el mueble que fuere materia delseguro.ARTICULO 54.- Lo dispuesto en los dosartculos anteriores no impedir que en elcontrato se pacten expresamentedeterminadas obligaciones a cargo delasegurado con el fin de atenuar el riesgo oimpedir su agravacin.ARTICULO 55.- Si el asegurado no cumplecon esas obligaciones, la empresaaseguradora no podr hacer uso de laclusula que la libere de sus obligaciones,cuando el incumplimiento no tengainfluencia sobre el siniestro o sobre laextensin de sus prestaciones.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 56.- Cuando la empresaaseguradora rescinda el contrato por causade agravacin esencial del riesgo, suresponsabilidad terminar quince dasdespus de la fecha en que comunique suresolucin al asegurado.ARTICULO 57.- Si el contrato comprendiesevarias cosas o varias personas, y el riesgono se agrava sino en lo que respecta a unaparte de las cosas o de las personas, elseguro quedar en vigor para las dems, acondicin de que el asegurado pague porellas la prima que corresponda conforme alas tarifas respectivas.ARTICULO 58.- La agravacin del riesgo noproducir sus efectos:I. - Si no ejerci influencia sobre el siniestroo sobre la extensin de las prestaciones dela empresa aseguradora;II. - Si tuvo por objeto salvaguardar losintereses de la empresa aseguradora ocumplir con un deber de humanidad;III. - Si la empresa renunci expresa o

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    Cundo la empresa rescinde el contrato por causa de agravacin esencial del contrato en que plazo terminar su responsabilidad?

    Cundo la agravacin esencial no producir sus efectos?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT36

    III. - Si la empresa renunci expresa otcitamente al derecho de rescindir elcontrato por esa causa. Se tendr porhecha la renuncia si al recibir la empresaaviso escrito de la agravacin del riesgo, nole comunica al asegurado dentro de losquince das siguientes, su voluntad derescindir el contrato.ARTICULO 59.- La empresa aseguradoraresponder de todos los acontecimientosque presenten el carcter del riesgo cuyasconsecuencias se hayan asegurado, amenos que el contrato excluya de unamanera precisa determinadosacontecimientos.ARTICULO 60.- En los casos de dolo omala fe en la agravacin del riesgo, elasegurado perder las primas anticipadas.ARTICULO 66.- Tan pronto como elasegurado o el beneficiario en su caso,tengan conocimiento de la realizacin delsiniestro y del derecho constituido a su favorpor el contrato de seguros, debern ponerloen conocimiento de la empresaaseguradora.Salvo disposiciones en contrario de lapresente ley, el asegurado o el beneficiariogozarn de un plazo mximo de cinco daspara el aviso que deber ser por escrito sien el contrato no se estipula otra cosa

    Qu plazo tendr el asegurado o beneficiario para notificar el siniestro a la aseguradora?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LEY SOBRE EL CONTRATO DE SEGUROARTICULO 67.- Cuando el asegurado o elbeneficiario no cumplan con la obligacinque les impone el artculo anterior, laempresa aseguradora podr reducir laprestacin debida hasta la suma que habraimportado si el aviso se hubiere dadooportunamente.ARTICULO 68.- La Empresa quedardesligada de todas las obligaciones delcontrato, si el asegurado o el beneficiarioomiten el aviso inmediato con la intencinde impedir que se compruebenoportunamente las circunstancias delsiniestro.ARTICULO 69.- La Empresa Aseguradoratendr el derecho de exigir del asegurado obeneficiario toda clase de informacionessobre los hechos relacionados con elsiniestro y por los cuales puedandeterminarse las circunstancias de surealizacin y las consecuencias del mismo.

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    Cundo el asegurado o el beneficiario no informen el siniestro de inmediato, a que tiene derecho la compaa aseguradora

    Una vez consumado el siniestro a que tiene derecho la compaa aseguradora?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT37

    ARTICULO 70.- Las obligaciones de laempresa quedarn extinguidas si demuestraque el asegurado, el beneficiario o losrepresentantes de ambos, con el fin dehacerla incurrir en error, disimulan odeclaran inexactamente hechos queexcluiran o podran restringir dichasobligaciones. Lo mismo se observar encaso de que, con igual propsito, no leremitan en tiempo la documentacin de quetrata el artculo anterior.ARTICULO 71.- El crdito que resulte delcontrato de seguro vencer treinta dasdespus de la fecha en que la empresahaya recibido los documentos einformaciones que le permitan conocer elfundamento de la formacin.

    Cundo pueden quedar extinguidas las obligaciones de una compaa de seguros.?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 76.- Cuando el contrato o esta ley hagandepender la existencia de un derecho de la observancia de unplazo determinado, el asegurado a sus causahabientes queincurrieren en la mora por caso fortuito o de fuerza mayor,podrn cumplir el acto retardado tan pronto como desaparezcael impedimento.

    ARTICULO 77.- En ningn caso quedar obligada la Empresa,si probase que el siniestro se caus por dolo o mala fe delasegurado, del beneficiario o de sus respectivoscausahabientes.

    ARTICULO 78.- La empresa aseguradora responder delsiniestro aun cuando ste haya sido causado por culpa delasegurado, y slo se admitir en el contrato la clusula quelibere a la empresa en caso de culpa grave.

    ARTICULO 79.- La empresa responder de las prdidas ydaos causados por las personas respecto a las cuales escivilmente responsable el asegurado; pero se admitir en el

    TITULO ICAPITULO IVEL RIESGO O LA REALIZACION DEL SINIESTRO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT38

    civilmente responsable el asegurado; pero se admitir en elcontrato la clusula de que trata el artculo anterior.

    ARTICULO 80.- Igualmente responder siempre que elsiniestro se cause en cumplimiento de un deber dehumanidad.

    CAPITULO V. PRESCRIPCIONARTICULO 81.- Todas las acciones que se deriven de un

    contrato de seguros prescribirn en dos aos contados desdela fecha del acontecimiento que les dio orgen.TITULO II CONTRATO DE SEGUROS SOBRE LOS DAOSCAPITULO I. DISPOSICIONES GENERALESARTICULO III.- La empresa Aseguradora que pague laindemnizacin se subrogar hasta la cantidad pagada, entodos los derechos y acciones contra terceros, que por causadel dao sufrido que correspondan al asegurado.(A) El derecho a la subrogacin no proceder en el caso enque el asegurado tenga relacin conyugal o de parentezco porconsanguinidad o afinidad hasta el segundo grado o civil conla persona que que haya causado el dao o bin si escivilmente responsable de la misma.

    ARTICULO 151

    El contrato de seguro sobre las personas comprende todoslos riesgos que pueden afectar a la persona del asegurado ensu existencia, integridad personal salud o vigor vital.

    En trminos generales, en que tiempo prescriben las acciones que se derivan de un contrato de seguros?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 151.- El contrato de seguro sobre las personascomprende todos los riesgos que puedan afectar a lapersona del asegurado en su existencia, integridadpersonal, salud o vigor vital.

    ARTICULO 152.- El seguro de personas puede cubrir uninters econmico de cualquier especie que resulte de losriegos de que trata este ttulo o bin dar derecho aprestaciones independientes en asboluto de toda prdidapatrimonial derivada del siniestro.

    En el seguro sobre las personas, la empresa aseguradora no podrsubrogarse en los derechos del asegurado o del beneficiario contralos terceros en razn del siniestro, salvo cuando se trata encontratos de seguros que cubran gastos mdicos o la salud.

    (A) El derecho a la subrogacin no proceder en el caso en que elasegurado tenga relacin conyugal o de parentesco porconsanguinidad o afinidad hasta el segundo grado o civi con lapersona que que haya causado el dao o bin si es civilmenteresponsable de la misma.

    ARTICULO 153.- La pliza del seguro sobre las personas.La empresa aseguradora estar obligada a entregar al

    contratante del seguro, una pliza en la que consten losderechos y obligaciones de las partes. La pliza debercontener:

    I. Los nombres, domicilios de los contratantes y firma de laempresa aseguradora;

    DISPOSICIONES ESPECIALES DEL CONTRATO DE SEGURO SOBRE LAS PERSONAS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    DISPOSICIONES ESPECIALES DEL CONTRATO DE SEGUROS SOBRE LAS PERSONAS

    EL CONTRATO DE SEGURO DE PERSONAS

    COMPRENDE:

    TODOS LOS RIESGOS QUE PUEDEN AFECTAR A LAPERSONA DEL ASEGURADO EN:

    SU EXISTENCIA INTEGRIDAD PERSONAL SALUD O VIGOR VITAL

    CCCC

    CCCCGGGGCTCTCTCTTTTT39

    empresa aseguradora;II.La designacin de la cosa o persona asegurada;III.La naturaleza de los riesgos garantizados;IV.El momento a partir del cual se garantiza el riesgo y la

    duracin de esta garanta;V.El monto de la garanta;VI.La cuota o prima del seguro, yVII.Las de ms clusulas que deban figurar en la pliza de

    acuerdo con las disposiciones legales, as como lasconvenidas lcitamente por los contratantes.

    En el seguro de personas particularmente debera contenerlo siguiente:

    -El nombre completo y fecha de nacimiento de la persona opersonas sobre quienes recaiga el seguro.

    - El nombre completo del beneficiario si no hay algunodeterminado

    - El acontecimiento o el trmino del cual dependa laexigibilidad de la suma asegurada

    - En su caso los valores garantizados.

    ARTICULO 154. La pliza del contrato de seguro de personas no podr ser al portador. La nominativa se transmitir mediante declaracin de ambas partes, notificada a la Empresa Aseguradora. La pliza a la rden se transmitir por medio de endoso que contenga, invariablemente la fecha, el nombre, y el domicilio del endosario y la firma del endosante. No se admitir prueba alguna de otra especie en esta forma de transmicin.

    En caso de designacin irrevocable de beneficiario este puede ceder su derecho mediante declaracin que, como lo previene el artculo 19 deber constar por escrito y, adems, ser notifcado al asegurador.

    Qu tipo de seguro no podr ser al portador?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    -ARTICULO 160.- Cuando se compruebe que huboinexactitud en la indicacin de la edad del asegurado, laempresa no podr rescindir el contrato, a no ser que laedad real al tiempo de su celebracin, est fuera de loslmites de admisin fijados por la empresa, pero en estecaso se devolver al asegurado la reserva matemticadel contrato en la fecha de su rescicin

    ARTICULO 161.- I.- Cuando a consecuencia de la indicacin inexacta de la edad, se pagare una prima menor de la que correspondera por la edad real, la obligacin de la empresa aseguradora se reducir en la proporcin que exista entre la prima estipulada y la prima de tarifa para la edad real en la fecha de celebracin del contrato;II.- Si la empresa aseguradora hubiere satisfecho ya el importe del seguro al descubrirse la inexactitud de la indicacin sobre la edad del asegurado, tendr derecho a repetir lo que hubiera pagado de ms conforme al clculo de la fraccin anterior, incluyendo los intereses respectivos;III.- Si a consecuencia de la inexacta indicacin de la edad, se estuviere pagando una prima ms elevada que la correspondiente a la edad real, la empresa estar obligada a reembolsar la diferencia entre la reserva existente y la que habra sido necesaria para la edad real del asegurado en el momento de la celebracin del contrato. Las primas ulteriores debern reducirse de acuerdo con esta edad.IV.- Si con posterioridad a la muerte del asegurado se descubriera que fue incorrecta la edad manifestada en la solicitud, y sta se encuentra dentro de los lmites de

    Cuando la edad del asegurado fue declarada inexactamente y esta se encuentra fuera de los lmites de admisin, que obligacin asume la Institucin ante el asegurado o el beneficiario?

    Cuando a consecuencia de la indicacin inexacta de la edad, se pagare una prima menor de la que correspondera por la edad

    real?

    Si la empresa aseguradora hubiere satisfecho ya el importe del seguro al descubrirse la inexactitud de la indicacin sobre la edad del asegurado?

    Si a consecuencia de la inexacta indicacin de la edad, se estuviere pagando una prima ms elevada que la correspondiente a la edad real?

    Si con posterioridad a la muerte del asegurado se descubriera que fue incorrecta la edad manifestada en la solicitud, y sta se

    CCCC

    CCCCGGGGCTCTCTCTTTTT40

    ARTICULO 163

    El asegurado tendr derecho a designar un tercerocomo beneficiario sin necesidad de consentimientode la empresa asegurada. La clusula beneficiariapodr comprender la totalidad o parte de losderechos derivados del seguro.

    ASEGURADO

    DESIGNACION DE BENEFICIARIOS

    Libremente

    Sin necesidad del consentimiento de la aseguradora

    Cambiar la designacin salvo los beneficiarios irrevocables

    ARTCULO 173.- Por herederos o causahabientesdesignados como beneficiarios deber entenderse,primero, los descendientes que deban suceder alasegurado en caso de herencia legtima y el cnyugeque sobreviva y despus, si no hay descendientes nicnyuge, las dems personas con derecho a lasucesin.

    la solicitud, y sta se encuentra dentro de los lmites de admisin autorizados, la empresa aseguradora estar obligada a pagar la suma asegurada que las primas cubiertas hubieren podido pagar de acuerdo con la edad real.Fraccin adicionada DOF 15-04-1946Para los clculos que exige el presente artculo se aplicarn las tarifas que hayan estado en vigor al tiempo de la celebracin del contrato.

    que fue incorrecta la edad manifestada en la solicitud, y sta se encuentra dentro de los lmites de admisin autorizados?

    Por herederos o causahabientes designados como beneficiarios deber entenderse?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.4 REGLAMENTO DE AGENTES DE SEGUROS Y DE FIANZASAGENTE DE SEGUROSTIPOS DE AGENTESCANALES ALTERNOS DE DISTRIBUCIONCARACTERISTICAS DE LA CEDULA

    REGLAMENTO DE AGENTES DESEGUROS Y DE FIANZASCAPTULO PRIMERODISPOSICIONES GENERALESARTCULO 1o.- Para efectos de esteReglamento se entender por:I.- Ley de Seguros, la Ley General deInstituciones y Sociedades Mutualistas deSeguros;II.- Ley de Fianzas, la Ley Federal deInstituciones de Fianzas;III.- Secretara, la Secretara de Hacienda yCrdito Pblico;IV.- Comisin, la Comisin Nacional deSeguros y Fianzas;V.- Aseguradora, la institucin de segurosautorizada conforme a lo establecido en la

    FIGURAS QUE INTERVIENEN EN EL FIGURAS QUE INTERVIENEN EN EL REGLAMENTO DE AGENTE DE SEGUROS.REGLAMENTO DE AGENTE DE SEGUROS.

    SECRETARIA DE HACIENDA Y CREDITO PUBLICO

    L L EEYY

    FFEE

    LLEEYY

    GGEEN.N.

    DDEE

    IINNSSTTIITTUUC.C.

    SOCIEDADESMUTUALISTAS AFIANZADORASINSTITUCIONES

    C.N.S.F.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT41

    autorizada conforme a lo establecido en laLey General de Instituciones y SociedadesMutualistas de Seguros;VI.- Afianzadora, la institucin de fianzasautorizada conforme a lo establecido en laLey Federal de Instituciones de Fianzas;REGLAMENTO DE AGENTES DESEGUROS Y DE FIANZASVII.- Institucin, la Aseguradora o laAfianzadora o ambas, segn corresponda;VIII.- Agente, la persona fsica o moralautorizada por la Comisin para realizaractividades de intermediacin en lacontratacin de seguros o de fianzas,pudiendo ser:a).- Personas fsicas vinculadas a lasInstituciones por una relacin de trabajo, enlos trminos de los artculos 20 y 285 de laLey Federal del Trabajo, autorizadas parapromover en nombre y por cuenta de lasInstituciones, la contratacin de seguros ode fianzas;

    DDEERRAALL

    DDEE

    FFIIAANNZZAASS

    C.C.

    YY

    SSOOCCIIEEDDAADDEESS

    MMUUTTUUAALLIISSTTAASS

    DDEE

    SSEEGG

    AGENTE PERSONA FISICA-Contrato Mercantil-Contrato Laboral

    APODERADO

    PERSONA MORAL

    FACULTADES EXPRESAS (art. 21 R.A.S.F.)Expedir PlizasModificarlas mediante endosoRecibir avisos y reclamacionesCobrar Primas Expedir recibosComprobar siniestros

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    b).- Personas fsicas independientes sinrelacin de trabajo con las Instituciones, queoperen con base en contratos mercantiles, yc).- Personas morales que se constituyancomo sociedades annimas para realizardichas actividades;IX.- Agente mandatario, el agentedesignado por las Instituciones para que asu nombre y por su cuenta acte confacultades expresas;X.- Apoderado, quien habiendo celebradocontrato de mandato con agentes personasmorales, se encuentre expresamentefacultado para desempear a su nombreactividades de intermediacin, yXI.- Actividades de intermediacin, las querealicen los agentes o los apoderados en lacontratacin de seguros o de fianzas.ARTCULO 2o.- Las actividades deintermediacin que pueden realizar losagentes y apoderados, consistirn en elintercambio de propuestas y aceptacin delas mismas, comercializacin yasesoramiento para la celebracin decontratos de seguros o de fianzas, suconservacin o modificacin, renovacin ocancelacin.ARTICULO 3o. Los agentes los apoderados

    INTERCAMBIO DE PROPUESTAS Y ACEPTACIONDE LAS MISMAS, COMERCIALIZACIN YASESORAMIENTO PARA LA CELEBRACION DECONTRATOS DE SEGUROS O DE FIANZAS, SUCONSERVACION O MODIFICACION,RENOVACION O CANCELACION

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CANALES ALTERNOS DE DISTRIBUCIN

    CCCC

    CCCCGGGGCTCTCTCTTTTT42

    ARTICULO 3o. Los agentes los apoderadosy las actividades de intermediacin sesujetarn a los dispuesto por las leyes deSeguros y de Fianzas, las dems leyesaplicables, las disponsiciones generales quede ellas emanen, por el presentereglamento y las orientaciones de polticageneral que en materia aseguradora o defianzas, segn corresponda seale laSecretara mediante reglas de carctergeneral; as como a la inspeccin yvigilancia de la Comisin.Los agentes y los apoderados estarnobligados a recibir las visitas de inspeccinde la Comision, a proporcionar a esta y a laSecretaria la informacion en la forma ytrminos que lo solicite y atender a susrequerimientos. Las cuentas que deben llevar los agentespersonas morales se ajustarnestrictamente al catlogo que al efectoautorice la Comisin, la que sealar losmodelos de registro y auxiliarescorrespondientes.

    VENTA DIRECTAPOR LAS

    INSTITUCIONES

    VENTA DIRECTACON

    INTERMEDIARIOS

    VENTA CONINTERMEDIARIOS

    BANCARIOS

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 5o. Los agentes y apoderadosde seguros debern informar a quin pretendacontratar un seguro, por lo menos de losiguiente:I.Su nombre completo, tipo de autorizacin,nmero y vigencia de su cdula, as como eldomicilio donde realiza sus activades, en elcaso de los apoderados de seguros, ladenominacin de la persona moral a la querepresente.II.Del alcance real de la cobertura en formaamplia y detallada, forma de contratarla,conservarla, mantenerla y darla por terminada.

    ARTCULO 14.- La autorizacin para actuarcomo agente persona fsica o apoderado, sehar constar en una cdula que contendr: sunombre; el sealamiento, en el caso de losagentes, de si actan por cuenta propia omediante una relacin de trabajo con unaInstitucin y en el caso de los apoderados ladenominacin de la persona moral querepresentan; las operaciones, ramos ysubramos que se les autorice a intermediar; lafecha de su expedicin; fotografa; el trminode su vigencia, y los dems datos quedetermine la Comisin.

    AGENTES PERSONAS FISICAS

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    SOBRE SU PERSONA SOBRE SU PLAN

    1. Alcance de la Cobertura

    2. Contratar3. Mantener4. Darla por trminada

    1. Nombre completo2. Tipo de autorizacin3. No. y Vigencia de

    cdula4. Domicilio donde realiza

    sus actividades

    CCCC

    CCCCGGGGCTCTCTCTTTTT43

    determine la Comisin.La autorizacin para actuar como agentepersona moral, se har constar en un oficio quecontendr su denominacin o razn social, lafecha de su expedicin y el trmino de suvigencia, as como las operaciones, ramos ysubramos que se les autorice a intermediar.En las autorizaciones para intermediar segurosde pensiones derivados de las leyes deseguridad social, en la cdula se deber incluirel nombre de la Aseguradora para la cualprestan sus servicios los agentes persona fsicao apoderados.En ningn caso se otorgar autorizacin a unmismo agente o apoderado para intermediarseguros de pensiones derivados de las leyesde seguridad social, con ms de unaAseguradora.Tampoco podr otorgarse a una mismapersona, autorizacin para actuar con ms deuna de las calidades a que se refiere el artculo1o., fraccin VIII, incisos a) y b) de esteReglamento.En caso de extravo o robo de la cdula, losagentes personas fsicas y los apoderadosestarn obligados, a su costa, a solicitar a laComisin la expedicin de un duplicado, dentrode un plazo no mayor de treinta das naturalesde ocurrido el hecho.

    APODERADO

    CEDULAS DEFINTIVAS

    AUTORIZACIONES PARA INTERMEDIAR SEGUROS DE PENSIONES DERIVADOS DE LAS LEYES DE SEGURIDAD SOCIAL ES

    EXCLUSIVA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.4 REGLAMENTO DE AGENTES DE SEGUROS Y DE FIANZASAGENTE DE SEGUROSTIPOS DE AGENTESCANALES ALTERNOS DE DISTRIBUCIONCARACTERISTICAS DE LA CEDULA

    La autorizacin para actuar como agentepersona moral, se har constar en un oficioque contendr su denominacin o raznsocial, la fecha de su expedicin y eltrmino de su vigencia, as como lasoperaciones, ramos y subramos que se lesautorice a intermediar.En las autorizaciones para intermediarseguros de pensiones derivados de lasleyes de seguridad social, en la cdula sedeber incluir el nombre de la Aseguradorapara la cual prestan sus servicios losagentes persona fsica o apoderados.En ningn caso se otorgar autorizacin aun mismo agente o apoderado paraintermediar seguros de pensiones derivadosde las leyes de seguridad social, con msde una Aseguradora.Tampoco podr otorgarse a una mismapersona, autorizacin para actuar con msde una de las calidades a que se refiere el

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    LOS AGENTES NO PODRN TENER LAS DOS CALIDADES

    En caso de extravo o robode la cdula, el agente

    podr solicitar a la CNSF un duplicado en un plazo

    de 30 das

    CCCC

    CCCCGGGGCTCTCTCTTTTT44

    de una de las calidades a que se refiere elartculo 1o., fraccin VIII, incisos a) y b) deeste Reglamento.En caso de extravo o robo de la cdula, losagentes personas fsicas y los apoderadosestarn obligados, a su costa, a solicitar a laComisin la expedicin de un duplicado,dentro de un plazo no mayor de treinta dasnaturales de ocurrido el hecho.ARTCULO 15.- La autorizacin a que serefiere el artculo anterior, en el caso deagentes personas fsicas y apoderadostendr una vigencia de tres aos y laComisin podr refrendarla por perodosiguales, siempre que el interesado no seencuentre en alguno de los supuestosprevistos por el artculo 13 de esteReglamento.Tratndose de agentes personas morales,la vigencia de la autorizacin podr serindefinida. En el supuesto de que sta seotorgue por tiempo definido, podr serrefrendada por perodos iguales siempreque el interesado no se encuentre enalguno de los supuestos previstos por elartculo 13 de este Reglamento.El trmite de refrendo de la autorizacin,deber ser realizado antes del vencimientode la misma, dentro de los ltimos sesentadas naturales de su vigencia.

    VIGENCIA

    TRAMITE PARA EL

    REFRENDO

    3 AOS

    DENTRO DE LOS ULTIMOS 60 DIAS

    NATURALES ANTES DE SU VENCIMIENTO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.5 LEY DE PROTECCION Y DEFENSA PARA EL USUARIO DEL SERVICIO FINANCIEROPROCEDIMIENTO DE ORIENTACION, CONCILIACION Y ARBITRAJE

    Ttulo quintoDe los procedimientos de conciliacin yarbitrajeCaptulo IDel procedimiento de conciliacin

    Artculo 60.- La Comisin Nacional estfacultada para actuar como conciliador entrelas Instituciones Financieras y los Usuarios,con el objeto de proteger los intereses deestos ltimos.Tratndose de diferencias que surjanrespecto al cumplimiento de fideicomisos, laComisin Nacional slo conocer de lasreclamaciones que presenten losfideicomitentes o fideicomisarios en contrade los fiduciarios.

    S.H.C.P.

    CONDUSEF

    Para que esta facultada esta comisin?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT45

    Artculo 61.- La Comisin Nacional noconocer de las reclamaciones porvariaciones de las tasas de inters pactadasentre el Usuario y la Institucin Financiera,cuando tales variaciones seanconsecuencia directa de condicionesgenerales observadas en los mercados.

    Artculo 62.- La Comisin Nacional podrrechazar de oficio las reclamaciones quesean notoriamente improcedentes.

    Artculo 63.- La Comisin Nacional recibirlas reclamaciones de los Usuarios con baseen las disposiciones de esta Ley. Dichasreclamaciones podrn presentarse ya seapor comparecencia del afectado, en formaescrita, o por cualquier otro medio idneo,cumpliendo los siguientes requisitos:I. Nombre y domicilio del reclamante;II. Nombre y domicilio del representante opersona que promueve en su nombre, ascomo el documento en que conste dichaatribucin;III. Descripcin del servicio que se reclama,y relacin sucinta de los hechos quemotivan la reclamacin;

    En que caso la CODUSEF no conocer las reclamaciones?

    Qu reclamaciones sern rechazadas?

    Por qu medios puede el usuario del servicio financiero presentar una reclamacin?

    Qu requisitos debe cumplir una reclamacin?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.5 LEY DE PROTECCION Y DEFENSA PARA EL USUARIO DEL SERVICIO FINANCIEROPROCEDIMIENTO DE ORIENTACION, CONCILIACION Y ARBITRAJE

    IV. Nombre de la Institucin Financiera contrala que se formula la reclamacin. La ComisinNacional podr solicitar a la Secretara y a lasComisiones Nacionales los datos necesariospara proceder a la identificacin de laInstitucin Financiera, cuando la informacinproporcionada por el Usuario sea insuficiente, yV. Documentacin que ampare la contratacindel servicio que origina la reclamacin. LaComisin Nacional estar facultada para suplirla deficiencia de las reclamaciones en beneficiodel Usuario.Las reclamaciones podrn ser presentadas demanera conjunta por los Usuarios quepresenten problemas comunes con una ovarias Instituciones Financieras, debiendoelegir al efecto uno o variosrepresentantes formales comunesArtculo 64.- Las autoridades a que se refiere lafraccin IV del artculo anterior, deberncontestar la solicitud que les formule laComisin Nacional en un plazo no mayor dediez das hbiles contados a partir de la fechaen que reciban la solicitud.

    En que plazo las Instituciones a las que la CONDUSEF les requiere informacin debern contestar a la solicitud de informacin?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT46

    en que reciban la solicitud.Artculo 65.- Las reclamaciones debern

    presentarse dentro del trmino de dos aoscontado a partir de que se suscite el hecho queles dio origen. La reclamacin podrpresentarse, a eleccin del Usuario, en eldomicilio de la Comisin Nacional o en laDelegacin de la misma que se encuentre msprxima al domicilio del Usuario, o en la UnidadEspecializada a que se refiere el artculo 50 Bisde esta Ley, de la Institucin Financiera quecorresponda.

    Artculo 66.- La reclamacin que rena losrequisitos sealados, por su sola presentacin,interrumpir la prescripcin de las accioneslegales correspondientes, durante el tiempoque dure el procedimiento.

    Artculo 67.- La Comisin Nacional corrertraslado a la Institucin Financiera acerca de lareclamacin presentada en su contra, dentro delos ocho das hbiles siguientes a la fecha derecepcin de la misma, anexando todos loselementos que el Usuario hubiera aportado, ysealando en el mismo acto la fecha para lacelebracin de la audiencia de conciliacin, conapercibimiento de sancin pecuniaria en casode no asistir.Tratndose de Instituciones de Fianzas, debercitarse al fiado en el domicilio que la Institucintuviere de ste o de su representante legal.

    En que plazo mximo debern presentar las reclamaciones los usuarios del servicio financiero?

    En donde debern presentarse las reclamaciones?

    En que tiempo la CONDUSEF le notificar a las Instituciones Financieras sobre la reclamacin presentada en su contra ?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.5 LEY DE PROTECCION Y DEFENSA PARA EL USUARIO DEL SERVICIO FINANCIEROPROCEDIMIENTO DE ORIENTACION, CONCILIACION Y ARBITRAJE

    Artculo 68.- En el caso de que el Usuariopresente reclamacin ante la ComisinNacional contra alguna Institucin Financiera,se deber agotar el procedimientoconciliatorio, conforme a las siguientes reglas:I. La Comisin Nacional citar a las partes auna audiencia de conciliacin que se realizardentro de los veinte das hbiles siguientescontados a partir de la fecha en que se recibala reclamacin;II. La Institucin Financiera deber, porconducto de un representante, rendir uninforme por escrito que se presentar conanterioridad o hasta el momento de lacelebracin de la audiencia de conciliacin aque se refiere la fraccin anterior;III. En el informe sealado se responderdetalladamente y de manera razonada atodos y cada uno de los hechos a que serefiere la reclamacin, en caso contrario,dicho informe se tendr por no presentadopara todos los efectos legales a que hayalugar;IV. La falta de presentacin del informe, no

    EN QUE CONSISTE EL PROCESO DE CONCILIACION ?

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Usuario

    Reclamacin

    Condusef

    Dicta Auto

    DesechaAdmite

    Institucin Financiera

    Rinde informe

    CCCC

    CCCCGGGGCTCTCTCTTTTT47

    IV. La falta de presentacin del informe, nopodr ser causa para suspender o diferir laaudiencia referida y sta deber darse porconcluida el da sealado para sucelebracin, salvo que por cualquiercircunstancia, a juicio de la Comisin Nacionalno pueda celebrarse en la fecha indicada,caso en el cual se deber verificar dentro delos cinco das hbiles siguientes;V. La falta de presentacin del informe a quese refiere el prrafo anterior har tener porcierto lo manifestado por el Usuario,independientemente de las sanciones a quehaya lugar de conformidad con lo sealado enesta Ley;VI. La Comisin Nacional cuando as loconsidere o a peticin del Usuario, en laaudiencia de conciliacin correspondiente odentro de los diez das hbiles anteriores a lacelebracin de la misma, podr requeririnformacin adicional a la InstitucinFinanciera, y en su caso, diferir la audienciarequiriendo a la Institucin Financiera paraque en la nueva fecha presente el informeadicional;

    Audiencia

    Exhorta a conciliar

    Aceptan

    Convenio

    No aceptan

    PasivoContingente

    Pide designen arbitro Amigable

    Composicin. Art 73

    Acudir a autoridad judicial competetnte a fin de resolver la controversia. Arts. 14 y 16 Constitucional

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.5 LEY DE PROTECCION Y DEFENSA PARA EL USUARIO DEL SERVICIO FINANCIEROPROCEDIMIENTO DE ORIENTACION, CONCILIACION Y ARBITRAJE

    La Comisin Nacional entregar al reclamante, contra pago de sucosto, copia certificada del dictamen tcnico, a efecto de que lopueda hacer valer ante los tribunales competentes, quienesdebern tomarlo en cuenta en el procedimiento respectivo;VIII. En caso de que las partes lleguen a un acuerdo para laresolucin de la reclamacin, el mismo se har constar en el actacircunstanciada que al efecto se levante. En todo momento, laComisin Nacional deber explicar al Usuario los efectos yalcances de dicho acuerdo; si despus de escuchar la explicacinel Usuario decide aceptar el acuerdo, ste se firmar por ambaspartes y por la Comisin Nacional, fijndose un trmino paraacreditar su cumplimiento;IX. La carga de la prueba respecto del cumplimiento del conveniocorresponde a la Institucin Financiera y, en caso de omisin, sehar acreedora de la sancin que proceda conforme a la presenteLey, y Artculo 69.- En el caso de que el Usuario no acuda a laaudiencia de conciliacin y no presente dentro de los diez dashbiles siguientes a la fecha fijada para su celebracinjustificacin de su inasistencia, se le tendr por desistido de lareclamacin y no podr presentar otra ante la Comisin ,debiendo levantarse acta en donde se haga constar lainasistencia del Usuario.(A) La falta de comparecencia del fiado o de su representante, no

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Qu documento podr la CONDUSEF entregar al reclamante, contra pago de su costo?

    Qu sucede cuando el usuario no acuda a la audiencia de conciliacion ?

    CCCC

    CCCCGGGGCTCTCTCTTTTT48

    (A) La falta de comparecencia del fiado o de su representante, no impedir que se lleve a cabo la audiencia de conciliacin.

    Artculo 70.- En caso de que la Institucin Financiera incumpla con cualesquiera de las obligaciones derivadas del convenio de conciliacin, la Comisin Nacional ordenar a la Institucin Financiera correspondiente que registre el pasivo contingente que derive de la reclamacin, o en su caso, como reserva en trminos de lo establecido en el artculo 68 fraccin

    Artculo 87.- Los Usuarios que deseen obtener los servicios de orientacin jurdica y defensora legal, estn obligados a comprobar ante la Comisin Nacional que no cuentan con los recursos suficientes para contratar un defensor especializado en la materia que atienda sus intereses.

    Artculo 91.- Los Defensores, durante el tiempo que desempeen dicho cargo, no podrn dedicarse al libre ejercicio de la profesin, salvo que se trate de actividades docentes.

    Artculo 92.- En caso de que un asunto represente, en cualquier forma, un conflicto de intereses para el Defensor asignado por la Comisin Nacional, aqul deber excusarse para hacerse cargo del mismo, y solicitar la asignacin de otro Defensor.

    Cuando la institucin financiera incumpla con cualquiera de las obligaciones del convenio de conciliacin Qu suceder?

    Cules son los requisitos para que al usuario le sea prestado el servicio de defensa legal gratuita?

    El defensor legal podr podr dedicarse al libre ejercicio de la profesin?

    Qu sucede si existe un conflicto de intereses para el defensor legal?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Artculo 140.-Para proceder penalmentepor los delitos previstos en los artculos 141 al146 y 147 al 147 bis 2 de esta ley, sernecesario que la Secretaria de Hacienda yCrdito Pblico formule peticin, previaopinin de la Comisin Nacional de Seguros yFianzas; tambin se proceder a peticin dela institucin o sociedad mutualista deseguros ofendidas, o de quien tenga intersjurdico.Las multas previstas en este capitulo, seimpondrn a razn de das de salario. Paracalcular su importe se tendr como base elsalario mnimo general diario vigente en eldistrito federal al momento de realizarse laconducta sancionada.la Secretaria de Hacienda y Crdito Pblico,oyendo la opinin de la Comisin Nacional deSeguros y Fianzas, dictara disposiciones decarcter general que tengan como finalidadestablecer medidas y procedimientos para

    S.H.C.P.

    C.N.S.F.OYENDO LA OPINICION DE

    DICTARA DISPOSICIONES DE CARCTER GENERAL CUYA

    FINALIDAD SEA:ESTABLECER MEDIDAS Y PROCEDIMIENTOSPARA PREVENIR Y DETECTAR EN LASINSTITUCIONES Y SOCIEDADES MUTUALISTAS DESEGUROS:ACTOS U OPERACIONES QUE REALICEN CONSUS CONTRATANTES, ASEGURADOS ,BENEFICIARIOS Y OTROS USUARIOS DE SUS

    I.6 OPERACIONES PARA LA PREVENCION Y DETECCION DE OPERACIONES DE PROCEDENCIA ILICITALAVADO DE DINEROFORMAS EN QUE OPERA EL LAVADO DE DINERODOCUMENTOS NECESARIOS DE IDENTIFICACION

    PARA PROCEDER PENALMENTE:

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT49

    establecer medidas y procedimientos paraprevenir y detectar en las instituciones ysociedades mutualistas de seguros, actos uoperaciones, que puedan ubicarse en lossupuestos del articulo 400 bis del cdigopenal para el distrito federal en materia defuero comn y para toda la republica enmateria de fuero federal, incluyendo laobligacin de presentar a esa secretaria, porconducto de la citada comisin, reportesperidicos sobre las operaciones yactividades que realicen con sus contratantes,asegurados, beneficiarios y otros usuarios desus servicios, por los montos y en lossupuestos, que en dichas disposiciones decarcter general se establezcan.Dichas disposiciones debern considerarentre otros aspectos, criterios para laadecuada identificacin de los clientes yusuarios de las operaciones y servicios delas mencionadas empresas aseguradoras,que consideren sus condiciones especificas yactividad econmica o profesional; losmontos, frecuencia, tipos y naturaleza de lasoperaciones e instrumentos monetarios conque las realicen y su relacin con lasactividades de los clientes o usuarios; lasplazas en que operen y las practicascomerciales, financieras y aseguradoras quepriven en las mismas; la debida y oportunacapacitacin de su personal y medidasespecificas de seguridad en el manejo delas operaciones de las propias empresasaseguradoras.

    BENEFICIARIOS Y OTROS USUARIOS DE SUSSERVICIOSPOR MONTOS QUE LAS DISPOSICIONES DECARCTER GENERAL ESTABLECEN.

    ESTAS DISPOSICIONES DEBERAN SER OBSERVADAS OPORTUNAMENTE POR LOS

    MIEMBROS DE LOS CONSEJOS DE ADMINISTRACION, COMISARIOS, AUDITORES

    EXTERNOS, FUNCIONARIOS Y EMPLEADOS DE LAS EMPRESAS DE SEGUROS

    CMO Y POR QUIEN SERA SANCIONADA LA VIOLACION DE ESTAS

    DISPOSICIONES?

    POR LA C.N.S.F. CON MULTA EQUIVALENTE DEL 10% al 100% DEL ACTO U OPERACION DE QUE SE TRATE

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Las disposiciones de carcter generalsealadas en el prrafo anterior y lasobligaciones previstas en ellas, debern serobservadas oportunamente por los miembrosde los consejos de administracin, comisarios,auditores externos, funcionarios y empleadosde las citadas empresas de seguros; laviolacin de las mismas ser sancionadapor la Comisin Nacional de Seguros yFianzas con multa equivalente del diez alcien por ciento del acto u operacin de quese trate.

    Tanto los servidores pblicos de la Secretariade Hacienda y Crdito Pblico y de la comisinnacional de seguros y fianzas, como losmiembros de los consejos de administracin,comisarios, auditores externos, funcionarios yempleados de las empresas de seguros a quese refiere este articulo, debern abstenerse dedar noticia o informacin de las operacionesprevistas en el mismo a personas,dependencias o entidades, distintas de lasautoridades competentes expresamenteprevistas. La violacin a estas disposicionesser sancionada en los trminos de las leyes

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    OPERACIONES PARA LA PREVENCION Y DETECCION DE OPERACIONES DE PROCEDENCIA ILICITA

    OPERACIONES RELEVANTES

    OPERACIONES INUSUALES

    OPERACIONES PREOCUPANTES

    MONTO IGUALES O

    EQUIVALENTES A $10,000 Dlls

    OPERACIN DUDOSA DE LA PER. FSICA O MORAL, RESPECTO AL MONTO, FRECUENCIA, TIPO Y NATURALEZA DE LA OPERACIN

    CCCC

    CCCCGGGGCTCTCTCTTTTT50

    ser sancionada en los trminos de las leyescorrespondientes.

    La presentacin de una identificacin por parte delcliente, previamente a la realizacin de lasoperaciones con instrumentos monetarios, pormontos iguales o superiores al equivalente a$10,000.00 dlls. de los E.U.A. Se danespecificaciones tanto para personas fsicas comomorales, nacionales y extranjeras.

    As mismo, las disposiciones de carcter generalindican que las Instituciones de seguros debernabrir un expediente de identificacin del cliente, quedeber contener:

    DOCUMENTOS QUE DEBERA PRESENTAR EL ASEGURADO CONTRATANTE

    CLIENTE

    QUE REALICE UNA OPERACION CON INSTRUMENTOS MONETARIOS POR

    MONTOS

    LAS INSTITUCIONES DE SEGUROS DEBERAN ABRIR UN EXPEDIENTE DE IDENTIFICACION DE CLIENTE QUE

    CONTENGA:

    INVOLUCRA PERSONAS DE LAS INSTITUCIONES

    CHEQUE DE VIAJEROEFECTIVOAMONEDADO : ORO O PLATA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    DOCUMENTOS QUE DEBERA PRESENTAR EL ASEGURADO CONTRATANTE

    1. PERSONAS FISICAS MEXICANAS.

    Identificacin personal oficial.Nombre Completo.Lugar y Fecha de Nacimiento.Nacionalidad.Profesin.Actividad o giro del Negocio.Direccin particular (calle, nmero, colonia,cdigo postal, ciudad, poblacin, entidadfederativa y telfono) y comercial en sucaso.

    Registro Federal de ContribuyentesCdula de identificacin Fiscal en el caso depersonas con actividades empresariales.

    1.1 PERSONAS FISICAS EXTRANJERASAdems de las anteriores, su Pasaporte.

    PERSONAS FISICAS MEXICANAS

    Identificacin personal oficial. Nombre Completo. Lugar y Fecha de Nacimiento. Nacionalidad. Profesin. Actividad o giro del Negocio. Direccin particular (calle, nmero, colonia, cdigo postal, ciudad,

    poblacin, entidad federativa y telfono) y comercial en su caso. Registro Federal de Contribuyentes Cdula de identificacin Fiscal en el caso de personas con

    actividades empresariales.

    PERSONAS FISICAS EXTRANJERAS

    Adems de las anteriores, su pasaporte

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT51

    Adems de las anteriores, su Pasaporte.

    2. PERSONAS MORALES MEXICANAS.

    Acta Constitutiva o documento en queconste su constitucin debidamente inscritoen el Registro Pblico de Comercio.Facultades o poderes del representante.Identificacin personal oficial delrepresentante.Registro Federal de Contribuyentes.Cdula de Identificacin Fiscal en el caso depersonas con actividades empresariales.Nombre del administrador, del director, delgerente general, apoderado legal quecelebre la operacin con la Institucin.Actividad o giro comercial.Comprobante de domicilio.

    Adems de las anteriores, su pasaporte

    PERSONAS MORALES MEXICANAS

    Acta Constitutiva o documento en que conste su constitucindebidamente inscrito en el Registro Pblico de Comercio.

    Facultades o poderes del representante. Identificacin personal oficial del representante. Registro Federal de Contribuyentes. Cdula de Identificacin Fiscal en el caso de personas con

    actividades empresariales. Nombre del administrador, del director, del gerente general,

    apoderado legal que celebre la operacin con la institucin. Actividad o giro comercial. Comprobante de domicilio.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    2.1 PERSONAS MORALES EXTRANJERAS:

    Adems de las anteriores, documento queacredite la existencia de la persona ydocumento que acredite como surepresentante a la persona fsica que seostente como tal (y en caso de que staltima tambin sea extranjera, su pasaporte.

    Tratndose de documentos expedidos en elextranjero, estos debern ser anlogos a losprevistos en el derecho civil mercantil.

    A.Deber establecerse un expediente deidentificacin del cliente, en el que seintegrar toda la documentacin, siendoresponsable la institucin de la suficiencia delexpediente, conservndolo en los plazos ycondiciones que se establecen en el captulorelacionado al archivo y conservacin de

    PERSONAS MORALES EXTRANJERAS

    Adems de las anteriores, documento que acredite la existencia de lapersona y documento que acredite como su representante a la personafsica que se ostente como tal (y en caso de que sta ltima tambin seaextranjera, su pasaporte.

    Tratndose de documentos expedidos en el extranjero, estos debern seranlogos a los previstos en el derecho civil mercantil.

    LA INSTITUCION DE SEGUROS

    ABRIRA EL EXPEDIENTE DE IDENTIFICACION DE

    CLIENTE

    ASEGURANDOSE DE LASUFICIENCIA DEL EXPEDIENTE YEL CUMPLIMIENTO DE TODOSLOS REQUISITOS.

    Y SERA RESPONSABLE DE RESGUARDAR Y CONSERVAR EL EXPEDIENTE DEL CLIENTE

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT52

    documentos de este manual.

    La Institucin deber asegurar elcumplimiento de todos los requisitos parallevar a cabo la debida identificacin de estemanual.

    Tratndose de operaciones de fideicomiso, laInstitucin fiduciaria, en el acto constitutivo dedichas operaciones, proceder a identificar alas partes que comparezcan a la suscripcindel contrato respectivo.

    Cuando en dichas operaciones hubiereincrementos o retiros efectuados porpersonas distintas a los fideicomitentesiniciales, la institucin fiduciaria tambinproceder a identificarlos al momento derealizar las operaciones, siempre que sean enun monto igual o superior al equivalente a $10,000.00 dlls. De los E.U.A. en cualquierinstrumento monetario.

    LOS REQUISITOS.

    OPERACIONES DE FIDEICOMISOS

    LA INSTITUCION FIDUCIARIA

    EN EL ACTO CONSTITUTIVO DE ESTASOPERACIONES PROCEDER A IDENTIFCARA LAS PARTES QUE COMPAREZCAN.

    CUANDO EN ESTASOPERACIONES: HUBIEREINCREMENTOS O RETIROSIGUALES O SUPERIORES A10,000.00 DLLS. POR PERSONASDISTINTAS A LOSFIDEICOMITENTES INICIALES. LA INSTITUCION FIDUCIARIATAMBIN PROCEDER A

    IDENTIFICARLOS ALMOMENTO DE REALIZAR LAOPERACIN

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    El Sistema Financiero Mexicano,Conjunto de personas y organizacionespblicas y privadas, a travs de lascuales se captan, administran, regulan ydirigen los recursos financieros que senegocian entre los diversos agenteseconmicos, dentro del marco de lalegislacin correspondientes.

    Secretara de Hacienda y CrditoPblico.- Es una dependenciagubernamental centralizada, integrantedel Poder Ejecutivo Federal, cuyo titulares designado por el Presidente de laRepblica. De acuerdo con lo dispuestopor la Ley Orgnica de la AdministracinPblica Federal y por su ReglamentoInterior. Instrumentar el funcionamientode las instituciones integrantes delSistema Financiero Nacional. Supervisay regula a las instituciones que forman el

    I.6 SISTEMA FINANCIERO MEXICANOLA ACTIVIDAD FINANCIERA EN MEXICO LAS INSTITUCIONES QUE OPERAN EN EL SISTEMA FINANCIERO MEXICANO, SU PROPSITO Y RELACIN ENTRE STIPOS DE INTERMEDIARIOS FINNACIEROS Y LAS DIFERENCIAS ENTRE ELLOSRELACIN ENTRE AUTORIDADES, INSTITUCIONES E INTERMEDIARIOS DEL SISTEMA FINANCIERO MEXICANO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Sistema Financiero Mexicano:

    SHCP

    CNSF

    CNBV CONDUSEF

    CONSAR

    BANXICO IPAB

    AFORES

    SIEFORES

    Aseguradoras

    Afianzadoras

    SistemaBancario

    ISES

    SociedadesMutualistas de

    Seguros

    SistemaBurstil

    OrganizacionesAuxiliares de Crdito

    Institucin de Depsitode Valores

    Bolsa deValores

    CCCC

    CCCCGGGGCTCTCTCTTTTT53

    y regula a las instituciones que forman elSistema Financiero, a travs de lasComisiones.

    Banco de Mxico, Es el banco centralde la nacin. Fue creado por la ley del 15de agosto de 1925 y constituido porescritura pblica el 1 de septiembre deese mismo ao. Actualmente se rige porla Ley del Banco de Mxico publicada el23 de diciembre de 1993correspondindole desempear lassiguientes funcionesEs una institucin independiente delpoder ejecutivo, teniendo como funcinla regulacin de todo lo referente alsistema de pagos.Organismo de carcter PblicoDescentralizado, con personalidad jurdica ypatrimonio propiosRegular la emisin y circulacin demoneda y crdito fijar los tipos de cambioen relacin con las divisas extranjeras.Operar como banco de reserva. Prestarservicio de tesorera al Gobierno Federal.representar al gobierno en el FondoMonetario Internacional

    Autoridades que integran el Sistema Financiero Mexicano:

    Es una dependencia gubernamental centralizada, integrante del Poder

    Ejecutivo Federal.Secretara de Hacienda

    y Crdito Pblico

    Banco de MxicoEs una institucin independiente del poder ejecutivo, teniendo como funcin la regulacin de todo lo referente al sistema de pagos.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    LAS INSTITUCIONES QUE OPERAN EN EL SISTEMA FINANCIERO MEXICANO, SU PROPSITO Y RELACIN ENTRE S.

    Bancos Comerciales o Instituciones de Crdito o de Banca Mltiple

    Banco de Desarrollo o Banco de Segundo Piso o Banco de Fomento

    Sociedades Financieras de Objeto Limitado o Sofoles

    Banco del Ahorro Nacional y Servicios Financieros (antes Patronato del Ahorro Nacional

    Bancos Comerciales o Instituciones de Crdito o de Banca

    Mltiple

    Son empresas que atravs de varios productos captan, es decir,reciben en dinero del pblico (ahorradores o inversionistas) y locolocan, es decir, lo prestan a las personas o empresas que lonecesitan y que cumplen con los requisitos para ser sujeto de crdito

    Banco de Desarrollo o Banco de Segundo Piso o Banco de Fomento

    Son banco dirigidos por el Gobierno Federal, cuyo propsito es desarrollar ciertos sectores (agicultura, autopartes,textil) atender y solucionar problemticas de financiamiento regionales o municipales o fomentar ciertas actividades (exportacin, desarrollo de proveedores, creacin de nuevas empresas) se les denomina de Segundo Piso, por que sus programas de apoyo o lneas de

    II SISTEMA FINANCIERO MEXICANO

    CCCC

    CCCCGGGGCTCTCTCTTTTT54

    Segundo Piso, por que sus programas de apoyo o lneas de financiamiento la realizan a travs de los bancos comerciales que quedan en primer lugar ante las empresas o usuarios que solicitan el prstamo.

    Sociedades Financieras de Objeto Limitado o Sofoles

    Banco del Ahorro Nacional y Servicios Financieros (antes

    Patronato del Ahorro Nacional

    Podemos llamarlos bancos especializados porque prestan slamente para un sector, por ejemplo: construccin, automotrz o actividad por ejemplo: consumo a travs de tarjeta de crdito, slo que en lugar de recibir depsitos, captan recursos teniendo que obtener dinero mediante la colocacin de valores o solicitando crditos.

    Es una institucin (Banca de Desarrollo) cuyo propsito es promover el ahorro, el financiamiento y la inversin, as como ofrecer instrumentos y servicios financieros entre los integrantes del sector. Dicho sector est conformado por la entidades de ahorro y crdito popular las cuales son:

    1- Sociedades de Ahorro y Prstamos y Sociedades Financieras Populares (antes cajas populares, cajas solidarias, sociedades de ahorro y prstamo).

    Fideicomisos Pblico Su propsito es apoyar cierto tipo de actividades definidas debidoa que cada uno es muy distinto no se pueden generalizar en sufuncionamiento, pero algunos son muy conocidos: INFONAVIT(Instituto del Fondo Nacional de la Vivienda para los trabajadores),FONACOT (Fondo de Fomento y Garanta para el Consumo de losTrabajadores), FOVI (Fondo de Operacin y FinanciamientoBancario a la Vivienda), FONATUR (Fondo Nacional de Fomento alTurismo) y otros ms.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TIPOS DE INTERMEDIARIOS FINNACIEROS Y LAS DIFERENCIAS ENTRE ELLOSRELACIN ENTRE AUTORIDADES, INSTITUCIONES E INTERMEDIARIOS DEL SISTEMA FINANCIERO MEXICANO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    TIPOS DE INTERMEDIARIOS FINANCIEROS Y LAS DIFERENCIAS ENTRE ELLOS.El prpsito de una institucin financiera es poner en contacto (intermediacin) a las personas que necesitan dinero (demandantes o que requieren que se les preste dinero) y a las personas que lo tienen (oferentes), personas que han podido acumular dinero mediante su hbito de gastar menos de los que realmente ganan, esto es financiamiento, adems cumple con la funcin de ayudar a la circulacin eficiente del dinero, esto es el sistema de pagos.Cuando las personas o empreas llevan su dinero a una institucin financiera (banco) estn buscando dos cosas:1.- Proteger su dinero, ya sea

    TIPOS DE INTERMEDIARIOS FINANCIEROS Y LAS DIFERENCIAS ENTRE ELLOS.

    Agentes Econmicos

    Agentes Econmicos

    Depositan$

    Empresas

    Familias

    Prestan$

    Cobran Intereses

    Ahorro Financiamiento

    Familias

    Empresas

    Gobierno

    PaganIntereses

    Banco

    Estn buscando cosas:1.- Proteger su dinero, ya

    Estn buscando cosas:2.- Para utilizar a las

    CCCC

    CCCCGGGGCTCTCTCTTTTT55

    1.- Proteger su dinero, ya sea ahorrando o inviertiendo para ganar ms. realizar diversas operaciones.2.- Para utilizar a las instituciones como un medio de pago y control de sus operaciones.

    1.- Proteger su dinero, ya sea ahorrando o inviertiendo para ganar ms. realizar diversas operaciones.

    2.- Para utilizar a las instituciones como un medio de pago y control de sus operaciones.

    Podemos llamarlos bancos especializados porque prestan slamente para un sector, por ejemplo: construccin, automotrz o actividad por ejemplo: consumo a travs de tarjeta de crdito, slo que en lugar de recibir depsitos, captan recursos teniendo que obtener dinero mediante la colocacin de valores o solicitando crditos.

    SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DEL CRDITO

    SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DEL CRDITO

    Empresas de factoraje

    Arrendadoras financieras

    Uniones de crdito

    Casas de cambio

    Almacenes generales de depsito

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DEL CRDITO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    EMPRESAS DE FACTORAJE.- Son empresas financieras que se dedican a adquirir, no necesariamente comprar, los derechos de cobro que tienen personas o empresas a travs de facturas, pagars, letras de cambio, contrarrecibos y otros ttulos de crdito. Al adquirir los documentos para cobrarle al deudor, es decir quin los firm, las empresas de factoraje pagan o adelantan dinero al dueo del derecho de cobro menos una comisin por el servicio, a esto tambin se le conoce como descuento de documentos. Se considera una operacin de crdito pues el vendedor de los derechos (dependiendo de la modalidad que elija factoraje con recurso o sin recurso), sigue siendo responsable de que el deudor pague, esto es como conceder un crdito al vendedor a cambio de las facturas. Por medio de esta operacin, la empresa de factoraje ofrece liquidez a sus clientes, es decir, la posibilidad de que dispongan de inmediato de efectivo para hacer frente a sus necesidades y obligaciones o bien para realizar inversiones.

    Arrendadoras financieras: Es el instrumento a travs del cual una empresa (la Arrendadora), se obliga acomprar un bien para conceder el uso de ste a otra persona (Arrendatario o cliente), durante un plazoforzoso, el arrendatario a su vez se obliga a pagar una renta, que pueden fijar desde un principio las partes,y en su caso los gastos accesorios aplicables. La gran ventaja del arrendamiento consiste en diferir el pagoen varias mensualidades y en su caso ejercer la opcin de compra, en lugar de la alternativa tradicional deefectuar un desembolso para el pago de contado.

    Uniones de crdito: Tienen por objeto facilitar el acceso del crdito a sus socios, prestar su garanta o aval,recibir prstamos de sus socios, de instituciones de crdito, de seguros y de fianzas. Para ser socio sedeber adquirir una accin o parte social de la propia institucin. Los socios a travs de la unin de crditopodrn comprar, vender y comercializar insumos, materias primas, mercancas y artculos diversos as comoalquilar bienes de capital necesarios para la explotacin agropecuaria o industrial..

    CCCC

    CCCCGGGGCTCTCTCTTTTT56

    alquilar bienes de capital necesarios para la explotacin agropecuaria o industrial..

    Casas de cambio: Son sociedades annimas dedicadas exclusivamente a realizar en forma habitual yprofesional operaciones de compra, venta y cambio de divisas con el pblico dentro del territorio nacional,autorizadas por la Secretara de Hacienda y Crdito Pblico, reglamentadas en su operacin por el Banco deMxico y supervisadas por la Comisin Nacional Bancaria y de Valores. Cabe mencionar que se entiendepor divisa a los billetes, monedas, cheques y ordenes de pago (money orders) en moneda extranjera.

    Almacenes generales de depsito: Tienen por objeto el almacenamiento, guarda o conservacin, manejo,control, distribucin o comercializacin de bienes o mercancas bajo su custodia o que se encuentren entrnsito, amparados por certificados de depsito y pudiendo otorgar financiamientos con garanta de losmismos. Tambin podrn realizar procesos de incorporacin de valor agregado, as como la transformacin,reparacin y ensamble de las mercancas depositadas a fin de aumentar su valor, sin variar esencialmentesu naturaleza. Slo los almacenes estarn facultados para expedir certificados de depsito y bonos deprenda; el certificado de depsito permite vender la mercanca sin tener que movilizarla hasta el lugardonde se realice la operacin de compraventa, mientras que el bono de prenda permite obtener crditoscon el respaldo o la garanta de la mercanca cuidada en el almacn.

    Fideicomisos Pblicos.- Su propsito es apoyar cierto tipo de actividades definidas debido a quecada uno es muy distinto no se pueden generalizar en su funcionamiento, pero algunos sonmuy conocidos: INFONAVIT (Instituto del Fondo Nacional de la Vivienda para los trabajadores),FONACOT (Fondo de Fomento y Garanta para el Consumo de los Trabajadores), FOVI (Fondode Operacin y Financiamiento Bancario a la Vivienda), FONATUR (Fondo Nacional de Fomentoal Turismo) y otros ms.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECTOR BURSTIL:

    El motivo por el que las instituciones financieras se agrupanen sectores es para tener relacionadas aquellas que realizanactividades similares o cuyos productos y servicios sonregulados por las mismas leyes y se se considera a:

    Casas de bolsa: Son empresas que ofrecen el servicio de intermediacin en elmercado de valores (BMV) entre aquellos que desean invertir su dinero, o bien lasempresas que requieren de algn tipo de financiamiento, estas operaciones se realizan atravs de instrumentos denominados valores. La intermediacin es cuando estasinstituciones financieras ponen en contacto a los inversionistas o personas que deseancomprar, vender o transferir entre ellos los valores; esta es la principal razn por la cuallas casas de bolsa no pueden garantizar ganancias al inversionista ya que ellas no son

    responsables de que tan bueno o malo es el instrumento que se compra.

    Sociedades de inversin y Operadoras, distribuidoras y administradoras desociedades de inversin: Son empresas cuyo fin es administrar inversiones en elmercado de valores. En este caso el usuario a travs de la operadora, distribuidora oadministradora compra y vende acciones de las sociedades de inversin en las queesta interesado en participar, y el usuario inversionista dependiendo del xito de la

    SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DEL CRDITO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT57

    esta interesado en participar, y el usuario inversionista dependiendo del xito de lasociedad tiene ganancias o prdidas. La gran diferencia en participar en el mercado devalores a travs de una casa de bolsa y una sociedad de inversin, es que en lasociedad de inversin un grupo de gente profesional toma las decisiones de cmoinvertir el dinero de todos los socios (es decir los accionistas) para obtener el mejorrendimiento posible de acuerdo al riesgo que se quiere tener. Esto es similar a las

    SIEFORES.

    Socios liquidadores y Socios operadores: Son empresas que ofrecen el servicio deintermediacin en el mercado de derivados (MexDer). Al igual que con las casas debolsa slo ponen en contacto a los compradores y vendedores por lo que no garantizanrendimientos.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECTOR SEGUROS

    Y FIANZAS

    El motivo por el que las instituciones financieras se agrupan ensectores es para tener relacionadas aquellas que realizanactividades similares o cuyos productos y servicios sonregulados por las mismas leyes y se considera a:

    Instituciones de seguros o Aseguradoras: Son empresas que a cambio de unpago, conocido como prima, se responsabilizan de pagar al beneficiario unasuma de dinero limitada o reparar el dao que sufra la persona o la cosaasegurada ante la ocurrencia del siniestro previsto cuando cumpla ciertosrequisitos indicados en un documento llamado pliza. Existen plizas paracubrir problemas como los accidentes y enfermedades personales, daos orobos en nuestros bienes, e incluso para planes de retiro o jubilacin.

    Sociedades Mutualistas de Seguros: Son instituciones de seguros en lascuales el cliente es considerado como un socio ms de la mutualidad, por locual si la empresa se desarrolla favorablemente puede pagar dividendosentre los usuarios

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DEL CRDITO

    Instituciones de fianzas: Son empresas que a cambio de un pago puedenotorgar fianzas, es decir garantizar que se cumplir una obligacin y si no la

    CCCC

    CCCCGGGGCTCTCTCTTTTT58

    El motivo por el que las instituciones financieras seagrupan en sectores es para tener relacionadasaquellas que realizan actividades similares o cuyosproductos y servicios son regulados por las mismasleyes y se considera a:

    Administradoras de fondos para el retiro (AFORES): Son empresas que administranel dinero de la cuenta individual del SAR del trabajador inscrito en el IMSS. Al administrar eldinero tienen la obligacin de informar mediante un estado de cuenta mnimo cada ao lacantidad ahorrada en la cuenta individual del trabajador que es invertida en una SIEFORE

    Sociedades de inversin especializadas en fondos para el retiro (SIEFORES):Son empresas a travs de las cuales las AFORES invierten el dinero de las cuentas

    individuales de los trabajadores para maximizar la ganancia buscando la proteccin delahorro para el retiro.

    SISTEMAS DE AHORRO PARA EL RETIRO

    otorgar fianzas, es decir garantizar que se cumplir una obligacin y si no laafianzadora le pagar al beneficiario una cantidad fijada en contrato de fianzapara restituir los daos que puede causar este incumplimiento del fiado.Cabe mencionar que slo las afianzadoras pueden cobrar por dar fianzas, yaunque las personas fsicas pueden firmar como fiadores no pueden cobrarle

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTITUCIONES DE APOYO

    Bolsa Mexicana de Valores (BMV)

    Entidades que facilitan las transacciones que se realizan en los mercadosfinancieros. Institucin constituida como Sociedad Annima de CapitalVariable, consecionada por la SHCP.

    Instituto para la Proteccin al Ahorro Bancario (IPAB)

    Organismo descentralizado de la Administracin Pblica Federal con personalidad jurdica y patrimonio propio. Cuyo objetivo es establecer un sistema de proteccin al ahorro bancario, concluir los procesos de saneamiento de las instituciones bancarias, as como administrar y vender los bienes a su cargo.El antecedente de esta institucin fue el POBAPROA.

    II SISTEMA FINANCIERO MEXICANOINSTITUCIONES DE APOYO

    El motivo por el que las instituciones financieras se agrupan ensectores es para tener relacionadas aquellas que realizanactividades similares o cuyos productos y servicios sonregulados por las mismas leyes y se considera a:

    CCCC

    CCCCGGGGCTCTCTCTTTTT59

    El IPAB respalda a los clientes de las instituciones banacarias, hasta por los lmites establecidos, actualmente a 400,000 UDIS.

    Instituto para el Depsito de Valores (INDEVAL)

    OTROS

    Instituto de intermediarios burstiles, constituida como sociedad annima de capital variable, supervisada por la CNBV

    Sociedad de Informacin Crediticia o Bur de Crdito.Sociedad de informacin sobre el comportamiento crdito de personas fsicas o morales. Para el otorgamiento de crdito las empresas recurren al burPROCESARAdministra y opera, en su caso la base de datos nacional del SAR, supervisada por la CONSAR.Calificadoras de valoresEntidades especializadas en el estudio de empresas, que emite opinin sobre la calidad crediticia de una emisin de ttulos de valores, supervida por la CNBV, instituciones del servicio a intermediarios burstiles.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TERMINOLOGIA BASICA

    COSTO DE OPORTUNIDAD

    Conjunto de bienes y derechos reales y personales sobre los que se tienepropiedad. Trmino contable-financiero con el que se denomina al conjuntode recursos econmicos con los que cuenta una persona, sociedad,corporacin, entidad, empresa o cualquier organizacin econmica

    Anualidad, renta anual, pago, o ingreso derivado de fondos cuyo fin esprecisamente el de proporcionar la base para el pago de una cantidad . Lasanualidades pueden ser tambin cualquier tipo de pago efectuado aintervalos regulares. se considera contingente, anticipadas e inmediatas

    Aquel costo en que se incurre al tomar una decisin y no otra. Es aquel valoro utilidad que se sacrifica por elegir una alternativa A y despreciar unaalternativa B. Tomar un camino significa que se renuncia al beneficio queofrece el camino descartado.

    La deflacin es la cada generalizada del nivel de precios de bienes y servicios en unaeconoma. Es el movimiento contrario a la inflacin

    Medio de cambio y medida de valor en el pago de bienes y /o servicios, ocomo descargo de deudas y obligaciones. Por su aspecto externo puede sermoneda cuando es de metal, o billete cuando es de papel. Tiene cuatrofunciones: como instrumento de cambio, como medida de valor, comoinstrumento

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    ANUALIDADES

    ACTIVOS:

    DINERO

    DEFLACION

    CCCC

    CCCCGGGGCTCTCTCTTTTT60

    instrumento

    Prctica que consiste en dividir los recursos financieros entre mltiplesinversiones con niveles de riesgo y rendimiento y fechas de vencimientodiferentes, para minimizar el riesgo total. Sirve para reducir lavariabilidad de la rentabilidad de las acciones.

    Erogacin o salida de recursos financieros, motivada por el compromiso deliquidacin de algn bien o servicio recibido o por algn otro concepto.Desembolsos o salidas de dinero, an cuando no constituyan gastos queafecten las prdidas o ganancias. En Contabilidad Gubernamental, los pagosse hacen con cargo al presupuesto de egresos.

    Movimiento o circulacin de cierta variable en el interior del sistema econmico. Lasvariables de flujo, suponen la existencia de una corriente econmica y se caracterizanpor una dimensin temporal; se expresan de manera necesaria en cantidades medidasdurante un periodo, como por ejemplo: el consumo, la inversin, la produccin, lasexportaciones, las importaciones, el ingreso nacional, etc.Es el incremento generalizado y sostenido de los precios de los bienes yservicios, producidos y vendidos por la economa de un pas. El alza generalde los precios es la principal consecuencia de la inflacin, no la inflacin ensi misma

    Son todos aquellos recursos que obtienen los individuos, sociedades ogobiernos por el uso de riqueza, trabajo humano, o cualquier otro motivoque incremente su patrimonio. En el caso del Sector Pblico, son losprovenientes de los impuestos, derechos, productos, aprovechamientos,financiamientos internos y externos; as como de la venta de bienes yservicios del Sector Paraestatal

    INFLACION

    DIVERSIFICACIN

    FLUJO

    EGRESO

    INGRESO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TERMINOLOGIA BASICALIQUIDEZ Disposicin inmediata de fondos financieros y monetarios para hacer frente a

    todo tipo de compromisos. En los ttulos de crdito, valores o documentosbancarios, la liquidez significa la propiedad de ser fcilmente convertiblesen efectivo

    Se negocian las acciones de la empresa.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    MERCADO ACCIONARIO Se integra mediante Valores de Renta Variable.

    Estos forman parte del Capital Social de la empresa emisora.

    LAS ACCIONESLAS ACCIONES.

    Ttulo valor que representa una de las fracciones iguales en que se divide el capital social de una Sociedad Annima.Titulo valor que representa una parte alcuota del capital social de una Sociedad Annima.Son ttulos nominativosSu plazo es indefinido.- en funcin a la vida de la empresa (100 aos)Rendimiento es variableSu precio de colocacin lo establece en el prospecto. ( conformado por el valor nominal ms una prima por venta de acciones, su valor posterior lo determina la ley de la oferta y la demanda, y la solidez de la empresa emisora)

    CCCC

    CCCCGGGGCTCTCTCTTTTT61

    Clases de AccionesClases de Acciones.

    Comunes u Ordinarias. Voz y Voto igual valor yse conoce como ordinarias.Preferentes o de Voto Limitado.- Slo derechospatrimoniales

    Derechos Patrimoniales Derechos Corporativos

    Participar de las utilidades de la empresa.

    Participar proporcionalmente del haber social en la liquidacin de la sociedad

    En su calidad de socio.Asistir y votar en las asambleas.Promover la convocatoria de

    asambleas.Conocer oportunamente la orden

    del da, as como;El balance y los libros de la

    sociedad.Oponerse a las decisiones de las

    asambleas.

    Se emiten en serie o en masa son grupo se acciones que tienen caractersticas homogneas.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TERMINOLOGIA BASICA

    MERCADO DE DINERO

    Aquel mercado en el que empresas e instituciones pblicas van a buscardinero con el que financiarse a largo plazo.

    Instrumentos de deuda que se negocian en el mercado de capitales, con duracinmayor a un ao, es decir a mediano y largo plazo.Entre mayor sea el plazo mayor el riesgo de la inversin.Se clasifica de acuerdo al tipo de instrumento en:a)Mercado accionario o de renta variable b) Mercado de deuda a largo Plazo

    b)La diferencia entre :1.- Tenedor de las acciones y 2.- Tenedor del instrumento es

    Socio de la empresa Acreedor (tiene derecho a pedir el cumplimientode una obligacin especial de pago)de la misma

    Los instrumentos de deuda quese negocian en el mercado de dinero tienenslas siguientes carctersticas:

    Se comercializan papeles a corto plazo (menorea a un ao) con suficienteliquidez y bajo riesgo.

    Emitidos por el Gobierno Federal, Empresas Privadas, Instituciones

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    MERCADO DE CAPITALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT62

    Emitidos por el Gobierno Federal, Empresas Privadas, Institucionesbancarias , buscan financiamiento a corto plazo.

    Representan un pasivo para el emisor y un activo para el tenedor.

    a) Instrumentos Gubernamentales

    Principales Instrumentos b) Instrumentos Bancarios

    c) Instrumentos emitidos por Empresas

    Tambin conocido como Mercado de Deuda o de Renta Fija.Certificados de la Tesorera de la Federacin CETES.Certificados de la Tesorera de la Federacin CETES.-- Apoya el Apoya el

    financiamiento del Gobierno en obligaciones a corto plazofinanciamiento del Gobierno en obligaciones a corto plazoBonos de Desarrollo BONDES Bonos de Desarrollo BONDES Bonos de Desarrollo del Gobierno Federal con Bonos de Desarrollo del Gobierno Federal con

    cupones de 28 y 91 das. cupones de 28 y 91 das. Financia requerimientos a mediano plazoFinancia requerimientos a mediano plazoUdibonos Udibonos Bonos del Gobierno Federal denominados en unidades de Bonos del Gobierno Federal denominados en unidades de

    inversin con cupones de 182 das. inversin con cupones de 182 das. Ligados al Indice Nal. de Precios a Ligados al Indice Nal. de Precios a Consumidor, protege la prdida del poder adquisitivo ante alza inflacionariaConsumidor, protege la prdida del poder adquisitivo ante alza inflacionaria

    Pagars de indemnizacin carretera (Fideicomiso Farac) emitidos en Pagars de indemnizacin carretera (Fideicomiso Farac) emitidos en unidades de inversin con cupones de 182 das. unidades de inversin con cupones de 182 das. PIC/FARAC o Certificados PIC/FARAC o Certificados Burstiles de Indemnizacin carretero segregableBurstiles de Indemnizacin carretero segregable, emitidos va BANOBRAS, emitidos va BANOBRAS

    Bonos a tasa fija, Bonos de desarrollo del Gobierno Federal con tasa de Bonos a tasa fija, Bonos de desarrollo del Gobierno Federal con tasa de inters fija y cupones de 182 das. inters fija y cupones de 182 das. Promueve el ahorro internoPromueve el ahorro interno

    United Mexican Status Bond (UMS) United Mexican Status Bond (UMS) deuda soberana emitida en dlares por deuda soberana emitida en dlares por el Gobierno Federal. el Gobierno Federal.

    Bonos de Proteccin al Ahorro (BPAs) Bonos de Proteccin al Ahorro (BPAs) Bonos de proteccin al ahorro Bonos de proteccin al ahorro emitidos por el IPAB con cupones de 28 dasemitidos por el IPAB con cupones de 28 das,, ttulos de crdito a mediano y ttulos de crdito a mediano y largo plazolargo plazo

    Bonos de Regulacin Monetaria (Brems).Bonos de Regulacin Monetaria (Brems).-- Regula la liquidez en el mercado Regula la liquidez en el mercado y facilita el manjeo de las operaciones.y facilita el manjeo de las operaciones.

    En el se negocia dinero, representado por ttulos-valores.

    Su objetivo es financiar el capital de trabajo a corto plazo.Se pueden hacer operaciones en Directo o en Reporto

    Valores Valores GubernamentalesGubernamentales

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTRUMENTOS Y SERVICIOS FINANCIEROS

    Pagar con Rendimiento Liquidable al Vencimiento (PRLV) Pagar con Rendimiento Liquidable al Vencimiento (PRLV) Financia operaciones a corto plazoFinancia operaciones a corto plazo

    ABABS, S, Aceptaciones Bancarias Burstiles. Aceptaciones Bancarias Burstiles. Letras de cambio que Letras de cambio que emite banca mltiple para financia operaciones a corto plazoemite banca mltiple para financia operaciones a corto plazo

    Bonos Bancarios de DesarrolloBonos Bancarios de Desarrollo Obligaciones SubordinadasObligaciones Subordinadas Certificados de Participacin Inmobiliaria (CpiCertificados de Participacin Inmobiliaria (Cpis)s) UDIPAGAR, Pagars Burstiles con rendimiento liquidable al UDIPAGAR, Pagars Burstiles con rendimiento liquidable al

    vencimiento indexado en unidades de inversin.vencimiento indexado en unidades de inversin. CDCDs, Certificados de Depsito. s, Certificados de Depsito.

    Papel Comercial.Papel Comercial.-- Financia capital de trabajoFinancia capital de trabajoPapel Comercial Indexado al tipo de CambioPapel Comercial Indexado al tipo de CambioPagar de Mediano Plazo. Pagar de Mediano Plazo. Emite las soc. mercantiles para Emite las soc. mercantiles para contraer pasivos y suscribir ttulos de crditocontraer pasivos y suscribir ttulos de crdito..ObligacionesObligacionesCertificado BurstilCertificado Burstil

    Se considera en este mercado a las Obligaciones y los Certificados de Participacin. Valores emitidos por las SA para obtener financiamiento del gran pblico inversionista a largo plazo.

    Valores Emitidos Valores Emitidos por Empresapor Empresa

    Valores BancariosValores Bancarios

    MERCADO DE DEUDA A LARGO

    PLAZOCLASIFICACION DE LAS OBLIGACIONES

    CCCC

    CCCCGGGGCTCTCTCTTTTT63

    Conjunto de normas y participantes (emisor, intermediario, inversionista , otros) que permiten el proceso de emisin, colocacin, distribucin e intermediacin de valores. Son valores las acciones, obligaciones y dems ttulos de crdito que se emitan en serie o en masa. Se clasifican en: Instrumento a Negociar Por su colocacin Por su liquidacinMercado de Dinero o a) Mercado Primario 1. Mercado Spot o Ttulo de Deuda o efectivoMercado de Capitales b) Mercado Secundario 2.Mercado de Futuros o Accionario

    Mercados Especializados

    CLASIFICACION DE LAS OBLIGACIONES

    POR LA GARANTIA QUE OTORGAN :

    QUIROGRAFARIAS.- Sin garanta.HIPOTECARIAS.-Gravamen de bien inmueblePRENDARIAS.-Garantiza con diversos muebles FIDUCIARIAS.-Constitucin fideicomiso

    CERTIF. DE DEPOSITO (CEDES) Y CERTIF. DE PART.

    ORDINARIA (CPOS) O BONOS DE PRENDA:

    Cuando el fideicomiso est constituido por bienes muebles

    CERTIFICADO DE PARTICIPACION INMOBILIARIA

    (CPIs) :

    instituciones crediticias con cargo a un fideicomiso cuyo patrimonio se integra por bienes inmuebles

    CERTIFICADOS DE PARTICIPACION

    MERCADO DE VALORES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTRUMENTOS Y SERVICIOS FINANCIEROS

    Colocacin de Valores en Oferta Pblica, previa autorizacin de la CNBVCompradores iniciales de nuevos valores, aporta recursos frescos a las empresas emisoras.Se negocian los valores, que quieren vender los tenedores primariosOtorga liquidez a los valores

    Mercados de Divisas especficas al mayoreo, mercado agrcola, mercadocientfico, mercado tecnolgico, etc

    Conjunto de obligaciones contradas con terceros por una persona, empresa oentidad

    Conjunto de bienes y derechos (menos obligaciones) de una persona,empresa o pas en un momento determinado, y que tienen un valoreconmico. En la empresa son los fondos propios, que representan el derechode sus propietarios sobre el valor de la empresa.

    Capacidad de compra de bienes y servicios que tienen los individuos a travsde los sueldos y salarios que perciben

    MERCADO PRIMARIO

    MERCADO MERCADO SECUNDARIOSECUNDARIO

    PASIVO

    MERCADOS ESPECIALIZADOS

    PATRIMONIO

    PODER ADQUISITIVO

    CCCC

    CCCCGGGGCTCTCTCTTTTT64

    de los sueldos y salarios que perciben

    Riesgo Posibilidad de ocurrencia de un hecho, Riesgo Puro.- Ocasiona una prdida realDesde el punto de vista inversionista, la inversin representa un riesgo, cuando los beneficios o rentabilidad o utilidad se incrementa, tambin se eleva e riesgo y la probabilidad de prdida.a) Incertidumbre sobre el valor de realizacin de una inversinb) Probabilidad de una prdida o ganancia financierac)Cuando el valor de realizacin se eleva por encima de lo esperado, hay una utilidadd) Cuando el valor esta por debajo de lo esperado hay prdida o munisvala.e) EL riesgo financiero se clasifica en: Riesgo de Marcado, Crdito, Liquidez, Operativo ( legal o tecnolgico), Tcnico,

    El riesgo de crdito es la posibilidad de que algn valor de los que integran la cartera, no sea pagado por el emisor al vencimiento (pago de intereses y/o capital).

    RIESGO FINANCIERO

    RIESGOS DE CRDITO

    RIESGO DE CRDITO

    AAA SobresalienteAA AltoA BuenoBBB AceptableBB BajoB MnimoCCC Muy AltoCC Muy AltoC Posible quiebra

    RiesgoRiesgo

    --

    ++

    CalificacinCalificacin

    --

    ++

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTRUMENTOS Y SERVICIOS FINANCIEROS

    El riesgo de crdito es la posibilidad de que algn valor de los que integran la cartera, no sea pagado por el emisor al vencimiento (pago de intereses y/o capital).En la toma de decisiones se recurre a la calificadoras internacionales en Mxico: Standard and Poors, Fitch y MoodysEl riesgo de mercado mide la sensibilidad que tiene una inversin frente a las condiciones de cambio del mercado.a)Un instrumento de tasa variable dependiente del INPC, tiene menos riesgo ya que su tasa se actualiza constantemente y el valor de dinero se conserva.b) Un instrumento de renta fija. Ante una inflacin en el que la tendencia de las tasas es a la alta, se considera muy alto riesgo.Es la vulnerabilidad que tiene el fondo de inversin de deuda ante el alza de las tasas de inters del mercado. Tipos de cambio, ndices de precios y los niveles de spreads. El riesgo de mercado es calificado con nmeros de acuerdo a la escala homognea de la CNBV.

    RIESGOS DE CRDITO

    RIESGOS DE MERCADO

    1 Extremadamente baja Sensibilidad2 Baja Sensibilidad3 Sensibilidad entre baja y moderada4 Sensibilidad Moderada5 Sensibilidad Moderada a alta6 Alta sensibilidad7 Muy alta sensibilidad

    RIESGO DE MERCADO

    Rie

    sg

    oR

    iesg

    o

    ++

    --

    CCCC

    CCCCGGGGCTCTCTCTTTTT65

    Prdida potencial por cambio de los factores de riesgo que inciden en el valor de los instrumentos financieros.1.- Riesgos de tasa de cambio.- Variaciones en las cotizaciones de las monedas. Fluctuaciones del tipo de cambio.2.- Riesgo de tipo de inters.- Cambios en las tasas de inters del mercado.3.- Riesgo de Precio.- Cambio en los precios del mercado.4.- Un instrumento se considera voltil, cuando su precio vara en relacin con la variacin del mercado.Tasa Nominal: Es la tasa ofrecida o publicada en doctos y expresada anualmente.

    Tasa Real: Es el rendimiento obtenido por la inversin, es decir ((VF / VP) 1) X 100=% ( Inversin de 100, termino con 95: resultado real 5%) (95 / 100) 1) X 100=-5 %,

    Tasa de Inflacin: Indicador del crecimiento sostenido de los precios de los bienes yservicios expresado en porcentaje con relacin a un periodo de tiempo, se calcula enbase al ndice nacional de precios al consumidor.

    Tasa de Inters: Es precio de dinero cantidad adicional que paga el inversionista acambio de obtener un crdito, expresada en porcentaje

    Tasa Activa: Es la que cobra el banco a quin le solicite un crdito.

    Tasa Pasiva: Es la que paga el banco a sus ahorradores. La diferencia entre activamenos pasiva, se le conoce como margen Spread.

    Tipo de Cambio: La tasa de cambio es el precio de la moneda de un pas expresado entrminos de la moneda de otro pas. En otras palabras, la tarifa por la cual una monedapuede cambiarse por otra.

    ++

    TASAS

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTRUMENTOS Y SERVICIOS FINANCIEROS

    SOCIEDADES DE INVERSION

    La tolerancia al riesgo se refiere a la capacidad de soportar cadas en elvalor de las inversiones durante un perodo relativamente largo de tiempo.

    La Ley de Sociedades de Inversin tiene por objeto regular la organizacin funcionamiento de las sociedades de inversin, la intermediacin de sus acciones en el mercado de valores, as como las autoridades y servicios correspondientes. Instrumento creado para el acceso del pequeo y mediano inversionista al Instrumento creado para el acceso del pequeo y mediano inversionista al mercado de valores, permitindoles diversificar riesgo y costo.mercado de valores, permitindoles diversificar riesgo y costo.

    El valor del dinero se mide en funcin de lo que se puede comprar; si aumenta su valor podr comprar ms cosas y si su valor desciende, comprar menos

    Elementos que integran un seguro universal 1.- Beneficio por muerte2.- Prima mnima o sugerida3.- Prima excedente4.- Fondos de inversin 5.- Retiros parciales

    VALOR DE DINERO

    TOLERANCIA AL RIESGO Y

    RENDIMIENTO

    Elementos que Elementos que integran un Seguro integran un Seguro UniversalUniversal

    CCCC

    CCCCGGGGCTCTCTCTTTTT66

    Clasificacin de los seguros de vida1.- Tradicionales.- slo orientado a la proteccin2.- Flexibles o universales.- orientados al ahorro3.- Anualidades o rentas.- garantizar vejez o educacin

    Son los seguros de tipo Dotal, que adems de proteccin ofrecen capitalizacin a largo plazo. Las modalidades son principalmente 1) Ahorro para planes a mediano plazo; 2) Ahorro para la Educacin de los hijos; y 3) Ahorro para el Retiro

    Clasificacin de los Seguros de Vida

    Relacin con los seguros que contemplan inversin

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    Analizaremos algunas reglas y procedimientos que se utilizan para calcular operacionesnumricas.Smbolos de las operaciones aritmticas:1. Adicin o suma: +2. Multiplicacin: x ( )3. Resta: 4. Divisin: / 5. Porcentaje: % y6. Exponente o elevar a la potencia: (X)7. Operaciones con Parntesis: (a + b)

    1. Ejemplos de Adiciones o sumas +. 5 + 6 = 11 7 + 10 = 17 13 + 5 = 18

    2. Ejemplos de Multiplicaciones x ( ) 6 x 5 = 30

    CCCC

    CCCCGGGGCTCTCTCTTTTT67

    6 x 5 = 30 (4) (3) = 12 7 (8) = 56

    3. Ejemplos de Restas .

    10 1 = 9 20 (4) = 16 (10) 6 = 4

    4. Ejemplos de Divisiones / , . 10 / 2 = 5 24 = 4

    6 60 / 10 = 6

    5. Ejemplos de Porcentajes %. 2 % = 2/100 = 0.02 (nmero natural) 20.5 % = 20.5/100 = 0.205 (nmero natural) 15 % = 0.15 (nmero natural), si se recorre el punto dos lugares a la izquierda 5 % = 0.05 (nmero natural), si se recorre el punto dos lugares a la izquierda

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL Para determinar un porcentaje de una cantidad determinada, se puede realizar de dos

    formas:

    Ejemplo: Cunto es el 10 % de $1,500.00?

    1. Se obtiene multiplicando $1,500.00 x .10 = $150.00

    2. Tambin se puede obtener de la siguiente operacin:

    $1,500 = 100 %

    Cunto es? = 10 %

    10 x $1,500 = $15,000.00

    $15,000 / 100 = $150.00

    6. Ejemplos con Exponentes o elevar a la potencia (X),

    Donde X es el nmero a elevar; y es el exponente.

    Elevar a la potencia un nmero, significa multiplicarlo por si mismo las veces que indica el

    exponente, por ejemplo:

    2

    (6) = 6 x 6 = 36.

    3

    (4) = 4 x 4 x 4 = 64.

    4

    CCCC

    CCCCGGGGCTCTCTCTTTTT68

    4

    (1.02) = 1.02 x 1.02 x 1.02 x 1.02 = 1.08243.

    En la calculadora se puede elevar a la potencia de acuerdo a los siguientes pasos:

    1. Se digita el nmero a elevar a la potencia y

    2. Se oprime la tecla (X) , en algunas calculadoras se oprime primero la teclayShift y despus la tecla de (X) .

    3. Posteriormente se oprime el nmero del exponente.

    4. Finalmente se oprime la tecla de =.

    7. Ejemplos de operaciones con parntesis (a + b)

    El procedimiento para la resolucin de operaciones con parntesis, ser el siguiente:

    1. Primero se realizan las operaciones que se encuentran dentro del parntesis.

    2. Posteriormente se realizan las operaciones de suma, resta, divisin o multiplicacin quese encuentran fuera del parntesis.

    4 + (6 x 5) = Primero: (6 x 5) = 30 Segundo: 30 + 4 = 34.

    3 + (.20 x 5) = Primero: .20 x 5 = 1 Segundo: 1 + 3 = 4.

    ( 7 x (50 / 2)) = Primero: 50 / 2 = 25 Segundo: 25 x 7 = 175.

    ( 4 / (100 / 2) ) = Primero 100 / 2 = 50 Segundo: 4 / 50 = 0.08

    Se observa que para agrupar utilizamos el parntesis ( ). Este signo en Finanzas indica

    agrupacin o asociacin y se refiere a que los nmeros encerrados deben efectuar su

    operacin en primer lugar.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    8. Notacin Porcentual a Notacin Decimal

    Las distintas tasas (de inters, rendimiento, inflacin, etc), se expresan en notacin porcentual. Para realizar operaciones aritmticas, es necesario convertirlas a notacin decimal. Realiza las conversiones:

    NOTACIN PORCENTUAL NOTACIN DECIMAL57% 0.5740% .4 .404% .0423.5% .2352.35% .0235

    9. Notacin Decimal a Notacin Porcentual NOTACIN PORCENTUAL NOTACION DECIMAL1/3 0.33312% 0.12

    CCCC

    CCCCGGGGCTCTCTCTTTTT69

    45% 0.455/9 0.551/4 0.25

    10. RAZONES:

    Es la comparacin de dos nmeros, cuntas veces est contenida una cantidad en otra:8 / 2 = 4 6 / 3 = 2 10 / 5 = 2

    PROPORCIONES: Es la equivalencia entre dos razones. Se conoce como regla de tres, en el mbito financiero tiene varias aplicaciones:

    A un agente de seguros le gusta vender plizas de Gastos Mdicos, producto que le ofrece una comisin del 17.5%,l desea ganar al final del ao la cantidad de $ 96,250.00, cunto es lo que deber pagar en primas para obtener esa comisin?

    96,250 --- 17.5% X --- 100% X= 96,250 X 100 = 550,000

    17.5a) 550.00b) 470.00c) 505.00d) 495.00

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    10. REGLA DE TRES:

    En una empresa el 65.85% de los empleados son mujeres. Si son 27 mujeres laborando, cuntas personas en total trabajan incluyendo hombres?

    65,85 --- 27% a) 17100% -- X X= 27 X 100 = b) 41

    65 c) 54d) 45

    El pap de Ana y Juan reparti $125,000.00 , de los cuales entreg 3/8 a Ana cunto le corresponde a Juan?

    a) 17b) 41c) 54d) 45

    La Sra. Juanita recibi $200.00 correspondiente al 16% de su tanda, cunto le faltapor recibir?

    a) $1,250.00b) $1,050.00c) $ 960.00d) $ 485.00

    CCCC

    CCCCGGGGCTCTCTCTTTTT70

    d) $ 485.00

    Juan Prez en las mismas condiciones de edad y riesgo, contrat una suma aseguradade $260.000.00 por la cual paga una prima de $8,000.00, cunto incrementar la suma asegurada, si tiene un incremento de $6,000.00, puede pagar $9,000.00 de prima?

    a) $ 292,500.00b) $305,000.00c) $350,000.00d) $ 275,000.00

    11.- PORCENTAJES:

    Qu porcentaje es $337.50 de $13,500.00 a) 15%

    337.50 = 0.025 x 100 = b) 2.5%13,500 c) 15%

    d) 10%

    Qu porcentaje es 38.5 de 254a) 18.28%

    38.5 = 0.1515 x 100 = b) 15.15%254 c) 33.25%

    d) 13.50%

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    12. INTERS SIMPLEEl inters es el precio del dinero y se puede definir en dos diferentes maneras:1. Lo tienes? es el premio que debers de recibir por depositarlo, invertirlo o prestarlo.2. No lo tienes? es el precio que debers pagar por obtenerlo.En otras palabras, el Inters es el dinero que se obtiene o se paga de acuerdo a una

    tasa de inters y a un tiempo previamente determinado.

    Una persona obtiene un prstamo por $50,000 y acepta liquidarlo ao y mediodespus . Mientras exista el adeudo pagar un inters simple mensual del 3.5%,cunto debe de pagar de inters cada mes?

    a) 1,750.0050,000 X 3.5% = b) 31,500.00

    c) 81,500.00d)51,750.00

    Se obtuvo un crdito por $180,000 para pagar en 120 das a una tasa de inters simpledel 2% mensual, qu cantidad debe pagar al vencerse la deuda?

    a) 144,000.00b) 172,800.00

    CCCC

    CCCCGGGGCTCTCTCTTTTT71

    c) 194,830.00d)194,400.00

    Calcule el monto total de $450.00 al 6% anual de inters simple durante 8 meses?

    a) 216.00b) 451.50c) 666.00d)468.00

    Calcule el monto total de $700.00 al 8% anual de inters simple durante 8 meses?

    a) 770.00b) 705.84c) 70.00d) 840.00

    De un capital de $7,00.00 a una tasa del 26% anual , cunto es al final de 15 meses?

    a) 13,412b) 9,200c) 7,123d) 8,916

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL 13. INTERS COMPUESTO

    La capitalizacin de una inversin es mensual, esto significa que en un ao tendr 12capitalizaciones: La formula para calcular el Inters Compuesto es la siguiente:

    VF = VP (1 + (i / m))VF = Valor futuroVP = Valor presentei = Tasa de inters nominal anualm = Nmero de capitalizaciones en el aon = TiempoExplicacin de la formula:

    VF = Valor Futuro, es la cantidad de dinero inicial ms los intereses que se obtendrn o

    se pagarn en un tiempo determinado, considerando las capitalizaciones que se

    tienen en dicho periodo (capital ms intereses).

    VP = Valor Presente, es la cantidad de dinero inicial que se invierte o bien se obtiene por

    un prestado.

    i = Tasa de inters nominal anual, es el porcentaje de inters que se tendr que obtener opagar por el dinero invertido o prestado, expresado como nmero natural.m = Nmero de capitalizaciones en el ao y se obtiene de dividir 360 entre los das en que se capitaliza la inversin.

    m x n

    CCCC

    CCCCGGGGCTCTCTCTTTTT72

    n = Tiempo, expresado en nmero de aos y se obtiene de dividir el nmero de das en que se mantiene la inversin entre 360 das.Determine el monto final de una inversin de $ 47,000 en un depsito bancario si la tasa deinters es del 5.5 % con capitalizaciones mensuales, s la inversin se mantiene durantetres y seis meses respectivamente.Datos:VF = VP = $ 47,000.00i = 5.5 % = 5.5 / 100 = 0.055m = 360 / 30 = 12n = 3 x 30 = 90 / 360 = 0.25 (para la inversin que se mantiene durante 3 meses).n = 6 x 30 = 180 / 360 = 0.5 (para la inversin que se mantiene durante 6 meses).Sustitucin de los datos en la formula, as como su operacin y resultado es el siguiente:

    a) 3 meses y b) 6 meses.

    12 x .25 12 x .5

    VF = $ 47,000 (1 + (.055 / 12)) VF = 47,000 (1 + (.055 / 12))

    VF= $ 47,000 (1+ 0.004583333) VF=$47,000 (1+ 0.004583333)

    VF = $ 47,000 (1.0045833) VF = 47,000 (1.0045833)

    VF = $ 47,000 (1.0138130) VF = 47,000 (1.0278168)

    VF = $ 47,649.21 VF = $ 48,307.38

    3

    63

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    La conclusin del ejemplo es la siguiente:La cantidad de dinero que se obtiene al cabo de un tres meses es de $ 47, 649.21,si a esta cantidad le restamos el capital inicial que fue de $ 47,000.00 nos dacomo resultado $ 649.21 que representa el inters que se logro por la inversindurante 3 meses.La cantidad de dinero que se obtiene al cabo de un seis meses es de $ 48, 307.38,si a esta cantidad le restamos el capital de inicial que fue de $ 47,000.00 nos dacomo resultado $ 1,307.38 que representa el inters que se logro por la inversindurante 6 meses.Es importante observar que es mayor el rendimiento de $ 1,307.38 por seis mesesque de $ 649.21 por tres meses, ya que la inversin se mantuvo ms tiempo.La Sra. Medrano invirti $ 3,000.00 a una tasa de inters del 36% capitalizablesemestralmente por un perodo de 2 aos, cul es el monto que tendr?

    4VF= 3000(1 + 0.36/ 2) a) 7,320.00VF 3000 ( 1 + 0.18) 4 b) 53,787.43VF 3000 ( 1 .18) 4 c) 5,816.33VF 3000 ( 1 .19387) d) 5,600.00VF = ?Una inversin de $18,500.00 a una tasa de inters del 15% anual de inters simple altrmino del ao tiene $21,275.00 si se maneja un inters compuesto con capitalizacin

    CCCC

    CCCCGGGGCTCTCTCTTTTT73

    trmino del ao tiene $21,275.00 si se maneja un inters compuesto con capitalizacinbimestral, cul sera el valor futuro?

    VF= a) 21,454.33VF= b) 24,880.44VF= c) 19,931.59VF= d) 21,473.96VF = ?Cul ser el monto al final de 18 meses de una cantidad de $ 500.00 si se invierte auna tasa de 18% anual capitalizable semestralmente.

    VF= a) 546.36VF= b) 821.51VF= c) 647.51VF= d) 760.43VF = ?

    Cunto valdr en 6 cuatrimestres un capital inicial de $ 27,000.00 que se invierte a unatasa de inters del 3.5% anual, si los intereses se reinvierten cada ao.

    VF= a) 56,620.00VF= b) 28,922.50VF= c) 45,630.00VF= d) 70,200.00VF = ?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Clculos bsicos financieros (matemticas)ARITMTICA ELEMENTAL

    TASA NOMINAL

    13. TASA NOMINAL

    Es la tasa ofrecida o publicada en doctos y expresada anualmente. Pactada en una operacin financiera, expresada en porcentaje. Se divide entre 100 para convertirla a Notacin porcentual.Ejemplo: Una tasa de inters del 38% anual, convertirla a notacin decimal.

    38/100= 0.38

    14. TASA EFECTIVA:

    Cuando convertimos la tasa de inters a tasa nominal a la que se va a recibir por el perodo de inversin y es la que utilizamos en nuestros clculos financieros.

    Ejemplo: 28% - 28 / 100 = 0.28Tasa diaria: 0.28 / 360Tasa mensual: 0.28 / 12Tasa bimestral: 0.28 / 6Tasa trimestral: 0.28 / 4Tasa cuatrimestral: 0.28 / 3Tasa semestral: 0.28 / 2 :

    Cuando hablamos de tasas mensuales se recomienda convertirlas a mensual y despus multiplicarla por los meses de inversin.

    1.- Convertir la tasa anual de 18% a una tasa de dos aos y medio.

    TASA EFECTIVA

    CCCC

    CCCCGGGGCTCTCTCTTTTT74

    TASA EQUIVALENTE

    1.- Convertir la tasa anual de 18% a una tasa de dos aos y medio.Paso 1 18/100 = 0.18Paso 2 Dos aos y medio = a 30 mesesPaso 3 0.18 / 12 x 30 =0.45 notacin porcentual = 45%

    II.- Convertir la tasa anual de 22% a una tasa de 8 meses Paso 1 22/100 = 0.22Paso 2 0.22 / 12 x 8 =0.14 67Paso 3 notacin porcentual = 14.67%

    15. Tasa Equivalente

    Se dice que dos tasas son equivalentes cuando al final del plazo dan el mismo resultado. En el caso anterior la tasa nominal del 22% es equivalente a una tasa del 14.67% por ocho meses.

    16. Tasa de Rendimiento

    Es la ganancia que se obtiene de lo que se invierte.

    TR= Valor final - 1 x 100Valor inicial

    TASA DE RENDIMIENTO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    INSTRUMENTOS Y SERVICIOS FINANCIEROS

    Ejemplo:Juan dispone de $40,000.00, y le ofrecen un carro de remate, cuyo valor comercial es de $50,000.00, Cul sera la tasa de rendimiento inmediata que obtendra si decide hace la operacin?

    TR = Valor final - 1 X 100Valor inicial

    TR 50,000.00 - 1 X 100 = 25%40,000.00

    Ejemplo:La empresa Bimbo invirti en la Bolsa de valores, la cantidad de $50,000.00 en acciones que vendi despus de 6 meses y obtuvo $67,000 Cul fue la tasa de rendimiento que obtuvo?

    TR = Valor final - 1 X 100Valor inicial

    CCCC

    CCCCGGGGCTCTCTCTTTTT75

    50,000.00 - 1 X 100 = 25%TR = 40,000.00

    Para convertir tasa de rendimiento efectiva a una tasa nominal anual, se multiplica por 360 das y se divide entre los das del plazo de la inversin.Tasa nominal = 34% x 360 / 180 = 68%Es la inflacin expresada en porcentaje, calculada generalmente en periodos anuales. El porcentaje refleja la prdida del valor del dinero.El Indice Nacional de Precios al Consumidor, es publicado por Banco de Mxico en forma mensual.Tasa Real.- Es la tasa de inters ajustada a la inflacin.Tasa de Rendimiento Real.- Se define como la tasa de inters nominal que se obtiene, corregida por el cambio del poder adquisitivo del dinero, Indica la tasa de inters que se recibe por encima de la inflacin. Resulta de identificar las diferencias entre las tasa nominales y las de inflacin.

    Tasa real = Tasa de inters nominal tasa de inflacin x 1001 + tasa de inflacin

    Pedro invirti en una cuenta de ahorro a una tasa de inters del 15%. La inflacin de ese ao fue del 5.3%, Cul es la tasa real que se recibi por su inversinTasa real = 0.15 0.053 = 0.09212 x 100 = 9.21%

    1 + o.o53

    TASA DE INFLACION

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT76

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TERMINOLOGIA BASICA

    CELEBRACION DEL CONTRATO

    PROPONENTE

    BENEFICIARIO

    ASEGURADO

    El Seguro se celebra por medio de un contrato por el cual una persona llamadacontratante transfiere su riesgo a una compaa aseguradora que lo protege medianteel pago de una aportacin.

    Quien primeramente solicita la celebracin de dicho contrato es el Proponente.Proponente es la persona que > su riesgo a una compaa aseguradorapara la celebracin de un contrato, debiendo llenar una solicitud para tal efecto.

    El proponente al llenar la solicitud deber designar Beneficiarios.El Beneficiario es la persona fsica o moral designada para recibir los beneficiosprevistos en el contrato.Por herederos o causahabientes designados como beneficiarios, deber entenderse,primero, los descendientes que deban suceder al asegurado en caso de herencialegtima y el cnyuge que sobreviva, y despus si no hay descendientes ni cnyuge,las dems personas con derecho a la sucesin. (Art. 173 LSCS)

    En s mismo o en sus bienes o intereses econmicos est expuesto al riesgo.

    HEREDERO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT77

    SUMA ASEGURADA Es el valor atribuido por el titular del contrato a los bienes cubiertos por la pliza y cuyoimporte es la cantidad mxima que el asegurador est obigado a pagar en caso desiniestro.

    Es el documento que forma parte muy importante del contrato de seguros; en ella sedescriben los datos que permiten la evaluacin del riesgo y el monto requerido comosuma asegurada.

    Es el documento que altera o modifica los trminos y condiciones del contrato deseguros, va sistema de emisin, mientras el contrato se encuentre en vigor.

    Cuando el Riesgo es Mayor al normal, se cobra un costo adicional llamadoExtraprima.

    Es el documento que refleja las normas generales, particulares o especiales delcontrato.

    A RIESGO NOMBRADO.- Se especfican las eventualidades contra las que estasegurada la persona o el bien.A TODO RIESGO.-Se cubren todos los riesgos excepto los especificados en lasexclusiones.

    SOLICITUD

    ENDOSO

    EXTRAPRIMA

    POLIZA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    TERMINOLOGIA BASICA

    Es la manifestacin concreta del riesgo, es un acontecimiento que por originarunos daos concretos previstos en la pliza obliga a la Aseguradora a pagar laindemnizacin.TIPOS DE SINIESTROS:SINIESTRO POR PERDIDA TOTAL.- Es aqul que ha afectado a la totalidaddel objeto asegurado o bien, los daos exceden de algn porcentajeestablecido por la aseguradora para considerarlo como prdida total.SINIESTRO POR PERDIDA PARCIAL- Es aqul que afecta solo a una partedel objeto asegurado.SINIESTRO DECLARADO.- Aqul en que el asegurado ya di aviso a laaseguradora.SINIESTRO PENDIENTE DE PAGO.-La compaa ha hecho procedente elpago de siniestro y se hacen los trmites para su liquidacin.SINIESTRO PAGADO.- Aqul liquidado en su totalidad.

    SINIESTRO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT78

    INTERES ASEGURABLE

    Inters Asegurable para el seguro de personas, es la relacin econmicaque existe entre un asegurado y el beneficiario en la cual, el fallecimiento delasegurado afecta econmicamente al beneficiario. (Art.152 LSCS)

    Inters asegurable para el seguro de daos, es el inters econmico queuna persona tenga en que no se produzca un siniestro o que una cosa no seadestruda o deteriorada. El inters asegurado equivale al que tendra unpropietario en la conservacin de la cosa. (Art.85 y 87 LSCS)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.1 RIESGOMUTUALIDADREASEGURORIESGOCLASIFICACION DEL RIESGORIESGOS ASEGURADOSACTITUDES FRENTE AL RIESGOCOASEGURODEDUCIBLE

    Desde su orgen el ser humano se ha visto inmerso en infinidad de riesgos, los cualesafectan a su persona o a su patrimonio, lo que le genera cierto grado de inseguridad. Solouna Institucin (seguro) basada en nobles principios de justicia y previsin ha resultado enrealidad efectivamente compensatoria del detrimento que significa un siniestro.Un mecanismo para la proteccin de los riesgos es:

    LA MUTUALIDAD

    Es una Entidad Aseguradora constituida por la asociacin de personas que sereparten entre s los riesgos que individualmente les corresponde, fijando lascantidades con que cada una de ellas habr de contribuir al resarcimiento de losdaos o prdidas colectivas. No producen lucro

    El objetivo fundamental de una mutualidad es la consecucin de la cobertura colectiva ymancomunada frente a los riesgos individuales de sus asociados, al mnimo costo posible,puesto que el precio de la garanta, solo estar representada, en lneas generales, por elimporte de las indemnizaciones satisfechas, ms los gastos de administracin.

    MUTUALIDAD

    Las Entidades Aseguradoras utilizan mecanismos para distribuir los riegos que aceptande sus asegurados, revisemos los conceptos ms conocidos.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT79

    REASEGUROde sus asegurados, revisemos los conceptos ms conocidos.

    Es el contrato por el cual una empresa de seguros toma a su cargo,total o parcialmente, un riesgo ya cubierto por otra el remanente dedaos que excedan a la cantidad asegurada por el asegurador directo.(art. 10 fracc II LG.I.S.M.S)

    Es la participacin de dos ms empresas en un mismo riesgo envirtud de contratos celebrados directamente por cada una de ellas conel asegurado (art. 10 fracc I LG.I.S.M.S)

    Es el convenio en virtud del cual una empresa de seguros se obliga areintegrar al contratante las primas o cuotas satisfechas o cubiertas,cuando se cumplan determinadas condiciones (art. 10 fracc IIILG.I.S.M.S)

    Salvo convenio en contrario la suma asegurada es inferior al valor delinters asegurable, (valor real del bien o cosa) la compaa de seguroscubrira las prdidas en forma proporcional aplicando la siguienteformula:SUMA ASEGURADA POR PERDIDA/ VALOR REAL = BASE INDEMNIZABLE

    (art. 92 L.S.C.S.)Cuando una cosa ha sido asegurada por un valor superior al que

    realmente tiene, la ley contempla dos posiblidades:a. Si existi dolo mala fe el contrato sera anulableb. Si no hubo dolo o mala fe el contrato ser vlido, pero solamente

    hasta por el valor real de las cosas, y el asegurado habr perdido lasprimas vencida por el perodo en curso hasta el momento del avisodel asegurado. (art. 95 L.S.C.S.)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGO

    Histricamente hablando, la palabra RIESGO proviene del vocablo ingls "RISK", quesignifica contingencia o proximidad de un dao.

    RIESGO: Posibilidad de sufrir una prdida o un dao.

    Cmo definimos el RIESGO RIESGO ASEGURABLEASEGURABLE PARA EFECTOS DEL SEGURO ?

    POSIBLE OCURRENCIA POR AZAR DE UN ACONTECIMIENTO QUEPRODUCE UNA NECESIDAD ECONMICA Y CUYA APARICIN REAL OEXISTENCIA SE PREVIENE Y GARANTIZA EN LA PLIZA, Y OBLIGA ALASEGURADO A EFECTUAR LA PRESTACIN NORMALMENTEINDEMINIZACIN QUE LE CORRESPENDE

    Adicionalmente a la defensa de su vida, el ser humano est sujeto a relacioneseconmicas, tambin para proteger su ncleo familiar y los bienes que le permiten lasatisfaccin de sus crecientes y complejas necesidades que la civilizacin va creando. Lainseguridad de la existencia humana como conciencia subjetiva de la poca estabilidad y laduracin de la propia vida y de los bienes que integran el patrimonio personal, cobra suautntico sentido en la apreciacin objetiva de las causas de dicha inseguridad: ELRIESGO.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT80

    CLASIFICACION DEL RIESGO Implican la presencia de una prdida real, siempre traen

    consecuencias adversas.

    Tiene su origen en hechos o acontecimientos de carcterextraordinario que por su natuaraleza anormal y la elevadaintensidad y cuanta de los daos que de ellos puedan derivarse.

    Afecta a alguna o algunas personas. Ej. accidenteAutomovilstico

    Envuelve tanto la posibilidad de prdida como de ganancia.

    Son susceptible de ser asegurable sin restricciones.

    Son susceptible de ser asegurable con algunas restricciones,o condicionantes.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Son aquellos que por su naturaleza son suceptibles de ser asegurados, esdecir cumplen con las caractersticas esenciales del riesgo.

    CARACTERISTICAS DE LOS RIESGOS ASEGURABLES

    CARACTERSTICAS DE LOS RIESGOS ASEGURABLES

    1.-2.-3.-4. -

    5. -6.-

    Sobre el riesgo ha de haber incertidumbre, principio bsico del seguroPosible

    Ha de existir la posibilidad de riesgo.Concreto

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT81

    El riesgo ha de ser analizado y valoradopor la aseguradora en dos aspectos, elcualitativo y el cuantitativo

    Contenido econmico

    El riesgo que se asegure no ha de ir encontra de las reglas morales o de ordenpblico, ni en perjuicio de terceros.

    Fortuito

    El riesgo debe provenir de un acto oacontecimiento ajeno a la voluntadhumana de producirlo.

    Lcito

    La realizacin del riesgo ha de produciruna necesidad econmica que sesatisface con la indemnizacincorrespondiente

    Incierto

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS ASEGURABLES

    Tratndose de las personas, todos estamos sujetos a los siguientes riesgos, mismosque pueden ser cubiertos mediante un contrato de seguro:

    Ya sea natural o accidental.

    Ya sea a causa de una enfermedad o por un accidente,que le impidan trabajar y por lo tanto obtener ingresos.

    Es decir llegar a la vejez sin recursos econmicos

    MUERTE

    INVALIDEZ

    SOBREVIVENCIA

    PREEXISTENCIA DE LOS RIESGOSFactores de daos, enfermedad u otras condiciones que existen y se detectan antesde la contratacin del seguro.

    ACTITUDES DEL SER HUMANO FRENTE AL RIESGO

    Consiste en erradicar las causas que puedan dar origen al riesgo (no es muyprctica) ya que no podremos eliminar la posibilidad o proximidad de que ocurraalgn siniestro.

    ELIMINACION

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT82

    algn siniestro.

    De acuerdo al riesgo que se trate, se puede adaptar equipos que permitan atacarel siniestro en el momento de que ocurra para evitar prdidas muy altas. Porejemplo: para el riesgo de incendio podramos instalar extinguidores, hidrantes,detectores de humo, etc.

    Hay que analizar las posibles causas del riesgo con el afn de bajar al mximo laprobabilidad de ocurrencia. Tendramos que analizar por qu razn podra ocurriralgn siniestro y de esta manera bajar la probabilidad de que suceda.

    Es aconsejable cuando la prdida mxima probable es muy baja, o cuando secuenta con los fondos necesarios para resarcir la prdida, en este caso la personase convierte en autoasegurador ya que l mismo pagar todos los daos quesufran sus bienes.

    Todos los miembros de una sociedad se ponen de acuerdo y aportan unacantidad determinada para resarcir el dao que haya sufrido uno de ellos.

    Consiste en hacer un convenio o contrato con alguna compaa de seguros paraque este se encargue de resarcir el dao sufrido.

    REDUCCION

    PREVENCION

    RETENER O ASUMIR

    DISTRIBUCION

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    FORMAS DE COMPARTIR EL RIESGO(DISTRIBUCION DEL RIESGO)

    Las Instituciones Aseguradoras utilizan algunas formas para compartir el riesgo conel asegurado.

    Cantidad o porcentaje establecido en una pliza cuyoimporte ha de superarse para que se pague unareclamacin.

    Es la participacin de dos ms Empresas de Segurosen un mismo riesgo, en virtud de contratos directosrealizados por cada uno de ellos con el asegurado. (art.10 fracc I)

    JURIDICAMENTE

    I.2 COSTO DEL SEGUROPROBABILIDADESTADISTICAPRIMAUTILIDADESDIVIDENDOSCOSTO DEL SEGURO

    Algunos conceptos bsicos para comprender como se determina el costo delseguro, son los siguientes:

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Segunda cantidad a cargo del asegurado y se establece en porcentajes del 10 al 20.

    CCCC

    CCCCGGGGCTCTCTCTTTTT83

    COSTO DEL SEGURO Es el grado de posibilidad, de que en elmbito de una muestra, se produzca unacontecimiento sometido al azar.Matematicamente se representa como elcociente que resulta de dividir el nmero totalde casos favorables entre la suma de todoslos casos posibles

    Es un tratamiento tcnico experimental deuna serie de datos, hechos o de suscircunstancias, en orden a conocer de modoglobal.

    Cifra o coeficiente que refleja el promedio denmero de siniestros que una pliza deseguros tiene, o el promedio de siniestros porao de todo un conjunto o cartera de plizas.

    Magnitud de la ocurrencia y monto de losdaos o prdidas.Tipos de Severidad:-Severidad Absoluta. Dato histrico que refleja elmonto de la prdida en un determinado evento uocurrencia.-Severidad Global. Implica la sumatoria o montototal de prdidad en un perodo de tiempo(generalmente un ao)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Las compaas actan con base en el principio llamado de Distribucin, es decir, con laaportacin econmica de muchos individuos expuestos al mismo riesgo (la prima de cadauno de ellos) crean un fondo con el cual hacen frente a las perdidas que efectivamentesufran algunos de ellos. Lo anterior es factible porque es casi imposible que todos losparticipantes en este proceso (asegurados) sufran las perdidas por el riesgo al que estnexpuestos. Por citar un ejemplo diremos que si se aseguran mil personas, hombres de 40aos todos en el ramo de vida, solo un pequeo nmero de ellos morir en un perododeterminado de tiempo, y las primas de los que no murieron podrn financiar el pago delas sumas aseguradas de los que fallecieron, de tal manera que la perdida no recae en unsolo individuo o en unos pocos, sino que se distribuye equitativamente entre todos.

    LA ESTADISTICA:Se basa en la experiencia previa, lo cual implica que a travs de los aos se lleva unregistro lo ms preciso posible del nmero de muertes que acontecen en un grupo ouniverso de personas.

    UTILIDAD DE ESTOS CONCEPTOS EN SEGUROS

    Si la estadstica no fuera utilizada, no se llevaran registros, no se analizaran los mismosde forma rigurosa, cualquier clculo o prediccin que se hiciera acerca del nmero demuertes futuro sera meramente especulacin, pues estara dictada por el azar.

    PROBABILIDADCon la probabilidad podemos anticipar con relativa certeza la posibilidad de que ocurranciertos acontecimientos en un perodo de tiempo establecido, y de acuerdo a ciertascircunstancias.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT84

    FUNCION PRINCIPAL DE UNA COMPAA

    DE SEGUROS

    Las compaas de seguros tienen como funcin principal, responsabilizarse por los riesgoseconmicos de sus clientes, los asegurados, en la medida en la que stos contraten dichaproteccin en una pliza de seguro, y mediante el pago de una cuota que para este efectocobra la aseguradora, llamada Prima.Esta prima no se cobra igual para todos, puesto que est relacionada con el grado deriesgo que corre cada cliente (ocupacin), el monto por el que se asegura (Sumaasegurada), su edad y su estado de salud.

    Este concepto surge, cuando en un contrato de seguro se establecen los derechos yobligaciones de un Asegurado, dentro de las cuales, est el de pagar una cantidad dedinero que cubre:

    CONCEPTO DEPRIMA

    Es la cantidad que paga el asegurado para tener derecho a laproteccin y sirve para que la aseguradora pueda cubrir; susobligaciones contractuales, los gastos de adquisicin, los gastosde administracin y la utilidad esperada

    Sus obligaciones contractuales Los gastos de

    adquisicin

    Gastos de administracin

    Utilidad esperada

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    METODOLOGIA PARA EL CALCULO

    DE PRIMASEl clculo de las primas esta basada en la Estadstica, mientras ms grande sea eluniverso y el perodo de tiempo que se estudia, ms confiables sern las predicciones quese puedan hacer para el futuro a esto se le llama Ley de los Grandes Nmeros.Cabe mencionar que estos registros estadsticos tienen que realizarse en forma continua ysin interrupcin, pues hay mltiples variables que pueden incidir en los resultados.El siniestro se manifiesta con periodicidad constante en un determinado lapso de tiempo yafecta por igual a un determinado nmero de personas u objetos asegurados, de estamanera se puede hacer el anlisis estadstico del siniestro y fijarse el precio del seguro oprima.Para calcular las primas se utilizan las tablas de mortalidad

    TABLAS DE MORTALIDAD

    EDAD NUM. DE NUM. DE PRIMA PURA DE

    Revisemos el procedimiento bsico que se sigue para determinar el monto de lasprimas:

    LEY DE LOS GRANDES NUMEROSLey matemtica que nos indca mediante estadsticas cual es el ndice de siniestralidad, con

    base en el nmero de riesgos medidos o asegurados.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT85

    EDAD NUM. DESOBREVIVIENTESAL INICIAR EL AO

    NUM. DEFALLECIMIENTOS

    PRIMA PURA DE RIESGO POR CADA

    $1,000 DE S.A.

    25 9575,636 18,481 1.93

    26 9557,155 18,732 1.96

    27 9538,423 18,981 2.00

    28 9519,442 19,324 2.03

    29 9500,118 19,760 2.08

    30 9480,358 20,193 2.13

    TASA DE MORTALIDAD =

    NUMERO DE FALLECIMIENTOS

    NUMERO DE VIVOS X 1,000

    TASA DE MORTALIDAD =

    20,193

    9,480,358= 2.1

    A EDAD 30 AOS

    Es la contribucin de cada uno de los asegurados para resarcir lasperdidas econmicas resultantes en el grupo de los fallecimientosocurridos.

    COSTODEL SEGURO

    Es el elemento ms importante de la tabla demortalidad, pues se toma como base paradeterminar el costo del seguro.

    TASA DE MORTALIDAD

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Las obligaciones contradas por las aseguradoras son a largo plazo y debido a lautilizacin de primas niveladas, es fundamental que los clculos se efecten sobrebases conservadoras de mortalidad, rendimiento financiero y presupuestos degastos.Las desviaciones favorables que se presentan en estos tres conceptos, generan un:

    Supervit que las compaas acostumbran compartir con susasegurados, proporcionalmente a las primas cubiertas por cadauno de ellos. Esta participacin que otorgan las compaasrecibe el nombre de Dividendos.

    DIVIDENDOS

    PRESUPUESTADO REAL

    Consiste en un porcentaje que, en determinado tipo de plizasconcede el asegurador al asegurado sobre los beneficiosobtenidos por aqul.

    PARTICIPACION DE UTILIDADES

    UTILIDAD (CONCEPTO)

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT86

    Dependiendo del tipo de plan contratado, y de las polticas de cada aseguradora, losdividendos se podrn otorgar a partir del segundo o tercer ao de vigencia de lapliza.Una vez que el asegurado adquiere el derecho de recibir los Dividendos, podr cobrarlosutilizando alguna de las siguientes opciones:

    1.- Aplicar el dividendo como parte del pago deprimas

    2.- Dejar el dividendo en un fondo.

    3.- Retirar el dividendo anualmente

    1.- Seguro Prorrogado

    2.- Seguro saldado

    BENEFICIOS DE LOS

    DIVIDENDOS

    EN EFECTIVO

    COMPRA DE PROTECCION

    GASTOS

    MORTALIDAD

    RENDIMIENTOS

    DIVIDENDOS

    RENDIMIENTOS

    MORTALIDAD

    GASTOS

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RESERVA

    ELEMENTOS QUE INTEGRAN EL COSTO TOTAL DEL SEGURO

    PRIMA NIVELADA

    SE CONSUMEN RESERVAS

    RESERVARepresenta los fondos combinados de todas las plizas retenidas por la compaa, loscuales, junto con las futuras primas e intereses suficientes para cubrir todas lasreclamaciones futuras, tiene como fin garantizar la solvencia de la aseguradora paraliquidar los compromisos contrados en sus contratos.

    Los gastos derivados directa o indirectamente de la actividad comercial de la entidadaseguradora; es decir retribucin de personal productor (comisiones) incentivos,subvenciones, etc. Publicidad y otros semejantes.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT87

    subvenciones, etc. Publicidad y otros semejantes.

    Conjunto de gastos generados y gastos de personal de la empresa

    Los gastos de administracin junto con los gastos de adquisicin y siniestrosconstituyen los tres captulos fundamentales de gastos de un entidad aseguradora.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RECARGOSRECARGOS (extraprimas)

    Los factores que ms influyen en la aplicacin derecargos estn basados en las ocupacionespeligrosas, la mala salud, los hbitos inadecuados, losdeportes peligrosos (an cuando existen otroselementos de valoracin).

    TARIFICACIONCon base en el anlisis de los factores que sirven de base para la seleccin del riesgo, sedetermina la prima individual que deber aplicarse a cada solicitante especfico.El punto de partidapara la tarificacin general se base en el 100% que califica a las personas como riesgo normal estndar, y esta determinado fundamentalmente por la edad.A la tarifa normal se agregan recargos extraprimas por factores subnormales que aumentanel peligro de siniestro. Asimismo se aplican descuentos cuando existen circunstancias favorables.

    RECARGO PORCENTUAL

    En este sistema se expresa el grado de subnormalidad como un porcentajesobre el estndar.Estos porcentajes se aplican unicamente sobre el elemento riesgo de la tarifa,por lo cual el incremento resultante no representa la misma proporcin sobre eltotal de la prima.RECARGO POR PRIMA FRACCIONADA ART. 37 AL 39 L.S.C.S.

    Aquella que, aunque calculada en perodos anuales, es liquidada por el aseguradomediante pagos peridicos ms reducidos (semanas, meses, trimestre, etc).Podr convenirse el pago de la prima en forma semestral, trimestral o mensual.Obviamente, con sus respectivos recargos por pagos fraccionados. As tambin, se

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT88

    DERECHO DE POLIZA

    Art. 22 y 23 L.S.C.S. Cantidad pagadera por el asegurado, por gastos de expedicin de pliza.La empresa aseguradora estar obligada a entregar al contratante del seguro, unapliza en la que conste los derechos y obligaciones de las partes, los gastos queorigine su emisin se cargan al asegurado.

    DERECHO DE POLIZA RECARGO FIJO

    Obviamente, con sus respectivos recargos por pagos fraccionados. As tambin, seconsiderar que cada pago fraccionado vencer al comienzo del perodo quecomprende.

    RECARGO AL MILLAR

    Se basa en llevar un recargo por millar de suma asegurada que se agrega a latarifa normal o estndar.

    DESCUENTOS

    Los factores ms frecuentes en la aplicacin de descuentos son:

    NO FUMADOR

    SEXO FEMENINO

    CONDICION FISICA

    Se reduce la edad en uno o dos aos, segn las polticas decada compaa

    Se reduce la edad en uno, dos o tres aos, segn las polticasde cada compaa, debido a que la expectativa de vida de lamujer es mayorCuando las condiciones de salud son excelentes, el solicitanteno fuma y adems es practicante asiduo de algn deporte nopeligroso, es posible que la Aseguradora otorgue estedescuento. Generalmente se reduce la edad en tres o hastacinco aos, an cuando algunas compaas podrn utilizaralgn otro tipo de frmulas, dependiendo del caso especfico.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    I.3 SINIESTROSDECLARACIONESAGRAVACIN DEL RIESGOCLARIDADPROCEDIMIENTOSTIEMPOS FORMAS DE AVISO

    AGRAVACIONES DEL RIESGOARTICULO 52.- El asegurado debercomunicar a la empresa aseguradora lasagravaciones esenciales que tenga el riesgodurante el curso del seguro, dentro de lasveinticuatro horas siguientes al momento enque las conozca. Si el asegurado omitiere elaviso o si l provoca una agravacinesencial del riesgo, cesarn de plenoderecho las obligaciones de la empresa enlo sucesivo.

    ARTICULO 53. - Para los efectos delartculo anterior se presumir siempre:I. - Que la agravacin es esencial, cuandose refiera a un hecho importante para laapreciacin de un riesgo de tal suerte que la

    DEBERA INFORMAR ASEGURADO ASEGURADORA

    Si el asegurado omitiere el aviso o si l provoca una agravacin esencial delriesgo, cesarn de pleno derecho las obligaciones de la empresa en lo sucesivo.

    LAS AGRAVACIONES ESENCIALES QUE TENGA EL RIESGO

    OBLIGACIONES Y DERECHOS DEL ASEGURADO Y LA COMPAA DE SEGUROS AL MOMENTO DEL SINIESTRO

    AGRAVACION DEL RIESGO

    AGRAVACION DEL RIESGO

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT89

    apreciacin de un riesgo de tal suerte que laempresa habra contratado en condicionesdiversas si al celebrar el contrato hubiereconocido una agravacin anloga;II. - Que el asegurado conoce o debeconocer toda agravacin que emane deactos u omisiones de sus inquilinos,cnyuge, descendientes o cualquiera otrapersona que, con el consentimiento delasegurado, habite el edificio o tenga en supoder el mueble que fuere materia delseguro.

    ARTICULO 58La agravacin del riesgo no producir susefectos:I. Si no ejerci influencia sobre el siniestro

    o sobre la extensin de las prestaciones dela empresa aseguradora,II. Si tuvo por objeto salvaguardar losintereses de la empresa aseguradora ocumplir con un deber de humanidad,III Si la empresa renunci expresa otcitamente al derecho de rescindir elcontrato por esa causa. Se tendr porhecha la renuncia si al recibir la empresaaviso escrito de la agravacin del riesgo, nole comunica al asegurado dentro de losquince das siguientes su voluntad derescindir el contrato.

    La agravacin esencialcuando se refiera a unhecho importante para laapreciacin de un riesgo

    El asegurado conoce odebe conocer todaagravacin que emane deactos u omisiones de susinquilinos, conyuge,descendientes o cualquieraque con su consentimientoeste asegurado

    LA AGRAVACION DEL RIESGO

    NO SURTIRA SUS EFECTOS CUANDO:

    Si no ejerci influencia sobre el siniestro Si tuvo por objeto salvaguardar los intereses de la aseguradora cumplir con un deber de humanidad Si la empresa renunci expresamente a su derecho de rescindir poresa causa

    Si dentro de un plazo de 15 das a partir de que recibe el aviso deagravacin, la aseguradora no comunica al asegurado su voluntad derescindir el contrato o cobrar una extraprima.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 66

    Tan pronto como el asegurado o elbeneficiario, en su caso tengan conocimientode la realizacin del siniestro y del derechoconstituido a su favor por el contrato deseguro, debern ponerlo en conocimiento dela empresa aseguradora.

    Salvo disposicin en contrario de la presenteley, el asegurado o el beneficiario gozarnde un plazo mximo de cinco das para elaviso, que deber ser escrito si en el contrariono se estipula otra cosa.

    ARTICULO 67

    Cuando el asegurado o el beneficiario nocumplan con la obligacin que les impone elartculo anterior, la Empresa Aseguradorapodr reducir la prestacin debida hasta lasuma que habra importado si el aviso sehubiere dado oportunamente

    ARTICULO 71El crdito que resulte del contrato de seguro vencertreinta das despus de la fecha en que la empresa

    REPORTE DEL SINIESTRO

    ASEGURADO BENEFICIARIO

    DEBERAN REPORTAR EL SINIESTRO EN UN PLAZO MAXIMO DE:

    .

    LA ASEGURADORA PODRA REDUCIR SU PRESTACION HASTA ELIMPORTE QUE HUBIERA ALCANZADO, SI EL REPORTE SEHUBIERA PRODUCIDO OPORTUNAMENTE

    SI LA DEMORA TUVO LA INTENCIN DE OCULTAR O SIMULARLAS CIRCUNSTANCIAS DEL SINIESTRO, LA ASEGURADORAQUEDARA LIBRE DE SUS OBLIGACIONES.

    SI NO CUMPLEN:

    PLAZO PARA EFECTUAR EL PAGO DE RECLAMACION

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT90

    treinta das despus de la fecha en que la empresahaya recibido los documentos e informaciones que lepermitan conocer el fundamento de la reclamacin.Ser nula la clusula en que se pacte que el crditono podr exigirse sino despus de haber sidoreconocido por la empresa o comprobado en juicio.

    ARTICULO 113

    Al ocurrir el siniestro, el asegurado tendr laobligacin de ejecutar todos los actos quetiendan a evitar o disminuir el dao. Si no haypeligro de demora, pedir instrucciones a laempresa aseguradora, debiendo atenerse alas que ella le indique.Los gastos hechos por el asegurado que no

    sean manifiestamente improcedentes, secubrirn por la empresa aseguradora, y sista da instrucciones, anticipar gastos.ARTICULO 114

    Sin el consentimiento de la Empresa, elasegurado estar impedido de variar elestado de las cosas, salvo por razones deinters pblico o para evitar o disminuir eldao, pero la empresa aseguradora debercooperar para que puedan restituirse a sulugar en el ms breve plazo.

    LAS RECLAMACIONES DE SINIESTROS

    DEBERAN SER PAGADAS EN

    UN PLAZO MAXIMO DE

    AL OCURRIR UN SINIESTRO

    EL ASEGURADO

    OBLIGACION DE:

    Ejecutar todos los actos que tiendan a evitar o

    disminuir el dao.

    El asegurado estar impedido de variar el estado de las cosas,

    salvo por razones de inters pblico o para evitar o disminuir

    el dao,

    Si no hay peligro dedemora, pedirinstrucciones a laempresa aseguradora,debiendo atenerse a lasque ella le indique.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SINIESTROEs la manifestacin concreta del riesgo. Es un acontecimiento que por originar unos daosconcretos previstos en la pliza, obliga a la aseguradora a pagar la indemnizacin.

    PERDIDA TOTAL PERDIDA PARCIALEs aqul que ha afectado a la totalidad delobjeto asegurado o bien, los daosexceden de algn porcentaje establecidopor la aseguradora para considerarlo comoprdida total

    Es aqul que afecta solo a una parte delobjeto asegurado

    FORMAS DE INDEMNIZACION

    EN EFECTIVOEN ESPECIEEN SERVICIO

    MODALIDADES DE INDEMNIZACION

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT91

    INDEMNIZACIONLa compensacin econmica que la aseguradoradebe pagar por el siniestro. Su fin es conseguiruna reposicin econmica en el patrimonio delasegurado afetado por un siniestro, a travs de lareposicin o sustitucin del objeto daado omediante el pago en econmico del valor de losbienes lesionados.

    Es la responsabilidad que asume laaseguradora, para indemnizar al asegurado enla misma proporcin que existe entre la sumaasegurada y su valor real de los bienes almomento del siniestro.

    Se indemniza la totalidad de la prdida sinaplicar reglas de proporcionalidad aunque lasuma asegurada sea inferior al valor real de losbienes establecindose como lmite mximo aindemnizar la suma asegurada contratada.

    VARIABLES QUE DELIMITAN LA INDEMNIZACION

    INFRASEGURO

    PROPORCION INDEMNIZABLE

    SEGURO A PRIMER RIESGO

    SOBRESEGURO

    DEDUCIBLE

    COASEGURO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT92

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    II.1 DEL AGENTEPOLIZA DE R.C.COBRO DE PRIMASCOMISIONESCESION DE DERECHOS

    R.A.S.F. 1. POLIZA DE RESPONSABILIDAD CIVILARTCULO 23.- Los agentes debern contratar ymantener vigente un seguro de responsabilidad civilpor errores y omisiones, por los montos, trminos ybajo las condiciones que la Comisin establezcamediante disposiciones de carcter general, a fin degarantizar el cumplimiento de las responsabilidadesen que puedan incurrir frente al pblico usuario, enrazn de las actividades de intermediacin querealicen.Los agentes debern de acreditar ante la Comisinla contratacin o la renovacin en su caso, de lapliza de seguro a que se refiere este artculo.Para efectos de lo establecido en el primer ysegundo prrafo de este artculo, la Comisinconsiderar el total de las primas que los agentesgeneren o puedan generar con su intermediacin, elmonto de las sumas aseguradas o garantizadas y,en su caso, el capital pagado con que cuenten.La Comisin podr eximir del cumplimiento deesta obligacin a los agentes, que intermedienexclusivamente operaciones, ramos y subramos,que por su naturaleza o caractersticas considereque no requiere de esta proteccin.Sin perjuicio de lo dispuesto en este artculo lasInstituciones, los agentes y apoderados podrn

    EL AGENTE

    DEBERA

    Con el propsito de garantizarel cumplimiento de lasresponsabilidades en quepuedan incurrir frente al pblicousuario, en razn de lasactividades de intermediacinque realicen.

    Los agentes debern de acreditarante la Comisin la contratacin ola renovacin en su caso, de lapliza de seguro a que se refiereeste artculo, en un plazo de 10das hbiles contado a partir delvencimiento de la pliza delseguro. (circular S1.5.2 de 29mayo 95)

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT93

    Instituciones, los agentes y apoderados podrnconvenir las garantas que determinen para elcumplimiento de las obligaciones que contraiganentre s.

    2. COBRO DE PRIMASARTCULO 24.- Los agentes slo podrn cobrarprimas contra la entrega del recibo oficial expedidopor las Instituciones. Las primas as cobradas seentendern recibidas directamente por lasInstituciones.Los agentes estn obligados a ingresar a lasInstituciones, en un plazo que no podr exceder dediez das hbiles contado a partir del da siguiente alde su recepcin, los cheques y el numerario quehayan recibido por cualquier conceptocorrespondiente a las plizas contratadas con suintermediacin, as como cualquier documento orecuperacin que les hubieren entregado conrelacin a dichas plizas.En los casos en que los contratantes de seguros olos asegurados, beneficiarios o terceros interesados,omitan pagar, dentro del plazo que establece elartculo 40 de la Ley sobre el Contrato de Seguro,las primas y dems prestaciones que hubierenasumido, los agentes estn obligados a devolver alas Aseguradoras los recibos, plizas y, en generaltodos los documentos que obren en su podercorrespondientes a los seguros contratados con suintermediacin, a ms tardar el tercer da hbilsiguiente al que hubiere vencido elreferido trmino.Los cheques que reciban los agentes por dichosconceptos, debern ser nominativos y a favor de lasInstituciones que asuman el riesgo o laresponsabilidad, salvo que las Instituciones autoricena los agentes a recibir los cheques a su propionombre. Esta autorizacin deber constarexpresamente y por escrito en un contrato demandato que para ese fin expreso otorguen lasInstituciones a los agentes.

    EL AGENTE COBRO DE PRIMASSOLO PODRAN COBRARPRIMAS CONTRA LA ENTREGADEL RECIBO EXPEDIDO PORLAS INSTITUCIONES. LASPRIMAS ASI COBRADAS SEENTENDERAN RECIBIDAS PORLAS INSTITUCIONESLOS CHEQUES DEBERAN SERNOMINATIVOS A FAVOR DE LAINSTITUCION

    INGRESO DE PRIMAS A LASINSTITUCIONESLOS AGENTES ESTN OBLIGADOS AINGRESAR A LAS INSTITUCIONES, ENUN PLAZO QUE NO PODR EXCEDERDE:

    CONTADO A PARTIR DEL DA SIGUIENTE AL DE SU RECEPCIN

    CONTRA LA ENTREGA DEL RECIBO OFICIAL EXPEDIDO POR LAS

    INSTITUCIONES

    OMISION DEL PAGODENTRO DEL TERMINOCONVENIDO NO PODRA SERINFERIOR A TRES DIAS NIMAYOR A 30 DIASNATURALES SIGUIENTES ALA FECHA DE SUVENCIMIENTO.

    LOS AGENTES ESTN OBLIGADOS A DEVOLVER A LAS ASEGURADORAS LOS RECIBOS, PLIZAS Y, TODOS LOS

    DOCUMENTOS QUE OBREN EN SU PODER, A MS TARDAR EL TERCER DA HBIL SIGUIENTE AL QUE HUBIERE VENCIDO EL

    REFERIDO TRMINO.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    R.A.S.F.COBRO DE COMISIONES

    ARTCULO 25.- Las Instituciones cubrirn alos agentes las comisiones a que tenganderecho durante el tiempo en que estn envigor las plizas contratadas con suintermediacin, an despus de extinguida larelacin que tuvieren con dichas Instituciones.Las Instituciones slo podrn pagarcomisiones y cualquier otra compensacin porla contratacin de seguros o fianzas aagentes, sobre las primas que efectivamentehayan ingresado a las Instituciones.Las comisiones que provengan de larenovacin o modificacin de una plizarespecto de un mismo riesgo oresponsabilidad asumida, correspondern alos agentes que hayan colocado la plizainmediata anterior, salvo que abandonen elnegocio, que su contrato de intermediacin sehaya rescindido sin responsabilidad para lasInstituciones, hubieren fallecido o elcontratante exprese por escrito a lasInstituciones que ya no desea laintermediacin de esos agentes o revoque sudesignacin nombrandouno distinto.En caso de fallecimiento del agente personafsica, el derecho al cobro de las comisiones

    LAS INSTITUCIONES

    CUBRIRAN A LOS AGENTES LAS COMISIONESA QUE TENGAN DERECHO DURANTE ELTIEMPO QUE ESTEN EN VIGOR LAS POLIZASPAGADAS, AUN DESPUES DE EXTINGUIDA LARELACION QUE TUVIERA EL AGENTE CON LAINSTITUCION.

    LAS INSTITUCIONES SOLO PAGARANCOMISIONES POR LA CONTRATACION DESEGUROS O FIANZAS, SOBRE LA PRIMASQUE EFECTIVAMENTE HAYAN INGRESADO ALAS INSTITUCIONES

    LAS QUE PROVENGAN DE RENOVACION OMODIFICACION DE UNA POLIZA, RESPECTODE UN MISMO RIESGO O RESPONSABILIDADASUMIDA

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT94

    CESION DE DERECHOS

    fsica, el derecho al cobro de las comisionespasar a sus legtimos causahabientes,durante el tiempo en que estn en vigor lasplizas de seguros o de fianzas respectivas.

    ARTCULO 26.- Los agentes que operen conbase en contratos mercantiles, as como suscausahabientes, podrn ceder a otrosagentes los derechos que lescorrespondan derivados de su cartera deplizas. Lo anterior deber hacerse delconocimiento de las Instituciones respectivas.Las Instituciones tendrn preferencia sobrelos derechos mencionados en el prrafoanterior, salvo el caso de cesin de talesderechos que hagan los agentes personafsica a los agentes personas morales de loscuales sean socios o con motivo de la fusinde dos o ms agentes personas morales. Elderecho de preferencia deber ejercerse enun plazo de quince das hbiles, contado apartir de la notificacin que a las propiasInstituciones les hagan los agentes o suscausahabientes.

    TRASPASO DE CARTERA

    AGENTE AGENTE

    SE PERMITIRA EL TRASPASO DE CARTERA DE UN AGENTE A OTRO SIEMPRE QUE:

    EL AGENTE ADQUIRIENTE ESTE AUTORIZADO PARA FUNGIR EN LOS RAMOS Y OPERACIONES DE QUE SE TRATE

    LAS ASEGURADORAS TENDRAN DERECHO DE PREFERENCIA, QUE DEBERA EJERCER UN PLAZO DE

    SALVO EN EL CASO DE AGENTE PERSONA FISICA A AGENTE PERSONA MORAL.

    EN CASO DE FALLECIMIENTO DEL AGENTEPERSONA FSICA, EL DERECHO AL COBRO DELAS COMISIONES PASAR A SUS LEGTIMOSCAUSAHABIENTES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    II.2 DE LA ASEGURADORACICLO DE VIDA DE UNA POLIZACONSTITUCION DE UNA COMPAA DE SEGUROS

    CICLO DE VIDA DE UNA POLIZA

    PROMOTORIARelacin

    Seleccin de Riesgos

    1a FASE POLIZA

    POLIZAEndosos

    Beneficios Adicionales

    2a FASE POLIZA

    PROMOTORIA

    3a FASE POLIZA

    AGENTEENTREGA DE POLIZA

    ASEGURADO

    1a. FASE SOLICITUD

    AGENTE PROSPECTO Designacin de

    Beneficiarios

    2a FASE SOLICITUD 3a FASE

    SOLICITUD

    ASEGURADORA

    SERVICIOSPAGO DE

    PARTICIPACION DEL AGENTE EN EL

    PROCESO ADMINISTRATIVO

    DEL CICLO DE VIDA DE UNA POLIZA

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT95

    La funcin administrativa que desempea el agente de seguros dentro el ciclo de vida deuna pliza en muy importante revisemos :

    PAGO DE SINIESTROS

    FIN

    LA SOLICITUDLLENADO CORRECTO DE LA SOLICITUDRecordemos que los agentes son los primerosseleccionadores del riesgo

    DESINGNACION DE BENEFICIARIOS

    Asesora para realizar una correcta designacin

    ENTREGA DE LA POLIZACon este hecho se cierra la primera etapa de la labor deintermediacin para el cliente este documento representala tranquilidad de que su familia esta segura.

    SERVICIOSMantener actualizada una pliza en cuanto a sumaasegurada, designacin de beneficiarios, cambio deresidencia etc., es una funcin importante para mantenervigente la pliza.

    COBRO DE PRIMASSin esta importante funcin administrativa el trabajo decomercializacin no se ver cristalizado.

    POLIZA

    COBRANZA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CAPITULO I L.G.I.S.M.DE LA ORGANIZACIONARTICULO 29.- Las institucionesde seguros debern serconstituidas como sociedadesannimas de capital fijo ovariable, con arreglo a lo quedispone la Ley General deSociedades Mercantiles, encuanto no est previsto en estaLey.I BIS. En razn del origen de losaccionistas que suscriban sucapital, las Instituciones podrnser:

    a. De Capital Total omayoritariamente Mexicano; ob. De capital Total omayoritariamente extranjero, encuyo caso se le considerarcomo filiales de InstitucionesFinancieras del exterior.

    CONSTITUCION DE UNA COMPAA DE SEGUROS

    INSTITUCIONES DE SEGUROS constituidas como:

    S.A. DE C.F.SOCIEDADES ANONIMAS DE

    CAPITAL FIJO

    S.A. DE C.V.SOCIEDADES ANONIMAS DE

    CAPITAL VARIABLE

    DEBERAN CONTAR CON UN CAPITAL MINIMO PAGADO POR CADA OPERACIN Y RAMO QUE SE LES AUTORICE.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    EL MONTO DEL CAPITAL SER DETERMINADO POR LA S.H.C.P. Y DEBER SER TOTALMENTE SUSCRITO Y PAGADO AL MOMENTO DE SU

    AUTORIZACIN Y ACTUALIZARSE AL 30 DE JUNIO DE CADA AO MEDIANTE

    CCCC

    CCCCGGGGCTCTCTCTTTTT96

    Financieras del exterior.

    PARA LA DETERMINACION DEL CAPITAL SE CONSIDERARA:

    RECURSOS NECESARIOS PARA LA ADECUADAPRESTACION DE SERVICIOS

    LA SUMA DE CAPITALES PAGADOS RESERVAS DE CAPITAL SITUACION ECONOMICA DEL PAIS ETC.

    AUTORIZACIN Y ACTUALIZARSE AL 30 DE JUNIO DE CADA AO MEDIANTE ACUERDO EXPEDIDO POR LA S.H.C.P. (FIJA UDIS).

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    REGLAS GENERALES

    QUE DICTA LA S.H.C.P. PARA MANTENER EL CAPITAL MINIMO PAGADO POR INSTITUCIONES

    EL ADECUADO APOYO A LOS RECURSOS PATRIMONIALES EN RELACION A LOS RIESGOS Y A LAS RESPONSABILIDADES QUE ASUMAN POR LAS OPERACIONES QUE EFECTUEN LAS INSTITUCIONES ASI COMO A LOS

    DISTINTOS RIESGOS A QUE ESTEN EXPUESTAS

    EL DESARROLLO DE POLITICAS ADECUADAS PARA LA SELECCIN DE RIESGOS EN LA CONTRATACION DE SEGUROS, ASI COMO LA DISPERSION DE

    REASEGURADORES EN LAS OPERACIONES DE SESION Y ACEPTACION DE REASEGURO Y DE REAFIANZAMIENTO;

    EL APROPIADO NIVEL DE RECURSOS PATRIMONIALES EN RELACION A LOS RIESGOS FINANCIEROS, QUE ASUMAN LAS INSTITUCIONES, AL INVERTIR LOS

    RECURSOS QUE MANTENGAN CON MOTIVO DE SUS OPERACIONES ..y

    LA DETERMINACION DE LOS SUPUESTOS Y DE LOS RECURSOS DE CAPITAL QUE LAS INSTITUCIONES DEBAN MANTENER CON EL PROPOSITO DE HACER

    FRENTE A SITUACIONES DE CARCTER EXCEPCIONAL QUE PONGAN EN RIESGO SU SOLVENCIA O ESTABILIDAD, DERIVADAS TANTO DE LA

    ARTICULO 60.-Las Instituciones de seguros, sinperjuicio de mantener el capitalmnimo pagado previsto en el artculo29 fracc.I de esta Ley, debenmantener recursos de capitalsuficientes para cubrir elrequerimiento de capital mnimo degaranta que resulte de aplicar losprocedimientos de clculo que laS.H.C.P. Determine mediante reglasde carcter general

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT97

    ARTICULO 46.- Las institucionesde seguros debern constituir lassiguientes reservas tcnicas:I. - Reservas de riesgos en curso;II. - Reservas para obligacionespendientes de cumplir;III.- (Derogada 16- 01- 02)IV. - Las dems previstas en estaLey.

    RESERVAS

    LAS RESERVAS NO PUEDEN SER UTILIZADAS PARA PROPOSITOS

    DIFERENTES DE SU OBJETIVO ESPECIFICO.

    LAS RESERVAS TECNICAS QUEDAN ASIGNADAS A CADA DEPARTAMENTO Y EN LA OPERACIN DE DAOS A CADA

    RAMO

    NO PODRAN SERVIR PARA GARANTIZAR OBLIGACIONES CONTRAIDAS POR

    POLIZAS EMITIDAS EN OTRAS OPERACIONES Y EN SU CASO EN OTROS

    RAMOS

    OPERACIN PARTICULAR DE LAS INSTITUCIONES, COMO DE CONDICIONES DE MERCADO.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ARTICULO 50.- Reservas paraobligaciones pendientes de cumplir

    RESERVAS

    ARTICULO 47.- Reservas deRiesgos en Curso

    Se destina a cubrir los siniestros ya ocurridos,cuya tramitacin est en proceso.Por plizas vencidas, por sinestrosocurridos y por repartos peridicos deutilidades, por siniestros ocurridos y noreportados.Reservas correspondientes a contratos quetengan como base planes de pensiones,relacionados con edad, jubilacin o retiro.

    Su finalidad es hacer frente a las obligacionesfuturas, derivadas de las operacionescelebradas.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT98

    RESERVA MATEMATICA ESPECIAL

    RESERVA PARA FLUCTUACIONES DE

    INVERSION

    ARTICULO 52 BIS I .- ReservaMatemtica Especial

    ARTICULO 52 BIS II .- ReservaMatemtica Especial

    Su propsito es apoyar a la aseguradora anteposibles variaciones en los rendimientos de suinversin.

    Se constituye para hacer la provisin de losposibles incrementos en los ndices desupervivencia de la poblacin asegurada.

    RESERVA DE PREVISION Tendr como propsito cubrir las posiblesdesviaciones estadsticas de la siniestralidadprevistas en las bases tcnicas

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    II.3 ANTE LAS AUTORIDADESTRAMITES PARA EJERCER COMO AGENTE

    REQUISITOS QUE ESTABLECE EL REGLAMENTO SE SEGUROS Y DE FIANZAS AL SOLICITAR LA AUTORIZACION:

    REQUISITOS PARA LA AUTORIZACION DEFINITIVA

    UNA FOTOGRAFIA TAMAO INFANTIL RECIENTE COPIA CERTIFICADA DEL ACTA DE NACIMIENTO

    EN SU DEFECTO ORIGINAL Y COPIA PARA SU COTEJO DE LA CARTILLA DELSERVICIO MILITAR NACIONAL O DEL PASAPORTE VIGENTE

    COPIA FOTOSTATICA DEL CERTIFICADO DE ESTUDIOS CON NIVELMINIMO DE PREPARATORIA O EQUIVALENTE

    EN SU DEFECTO, HISTORIAS ACADEMICAS DE INSTITUCIONES INCORPORADAS ALSISTEMA EDUCATIVO NACIONAL O CEDULAS PROFESIONALES, ASI COMO SUORIGINAL PARA EFECTOS DE COTEJO O, EN SU CASO, COPIA CERTIFICADA ANTEFEDATARIO PUBLICO.

    COPIA FOTOSTATICA DE LA CEDULA DE IDENTIFICACION FISCALEN SU DEFECTO, DEL ALTA ANTE LA SECRETARIA DE HACIENDA Y CREDITOPUBLICO, DEL FORMATO DE AVISO DE MODIFICACION DE SALARIOS DELTRABAJADOR EMITIDO POR EL IMSS., DE LA CLAVE UNICA DE REGISTRO DEPOBLACION (CURP) O DEL COMPROBANTE DE APORTACION DEL SISTEMA DEAHORO PARA EL RETIRO.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT99

    COPIA DEL COMPROBANTE DE DOMICILIOQUE PODRA SER BOLETA DE PAGO, DE IMPUESTO PREDIAL, RECIBO DE PAGO DERENTA, AGUA, TELEFONO, LUZ, GAS O ESTADOS DE CUENTA EMITIDOS POR LAINSTITUCION BANCARIA O FINANCIERA.

    PAGO DE DERECHOSCOMPROBANTE DE HABER EFECTUADO EL PAGO DE DERECHOSCORRESPONDIENTE

    COPIA DEL CONTRATO MERCANTILEN EL CASO DE CATEGORIAS G Y H COPIA DEL CONTRATO DE COMISIONMERCANTIL CELEBRADO CON LA INSITUCION CORRESPONDIENTE.

    ORIGINAL Y COPIA DE LA F.M.2 o CARTA DE NATURALIZACIONTRATANDOSE DE PROSPECTOS DE AGENTES DE ORIGEN EXTRANJERO,ADICIONAL A LA DOCUMENTACION ANTERIORMENTE SEALADA, DEBERANPRESENTAR ORIGINAL Y COPIA DE LA F.M.2 O CARTA DE NATURALIZACION.

    ACREDITAR SU CAPACIDAD TECNICADE IGUAL MANERA, DEBERAN ACREDITAR SU CAPACIDAD TECNICA ANTE ESTA

    COMISION EN LOS TERMINOS DE LA CIRCULAR S-1.8 Y LAS DEMASDISPOSICIONES APLICABLES.

    RECIBIDA LA SOLICITUD DE AUTORIZACION DEFINITIVA, A TRAVES DE LA FORMA FAS2, PREVISTA EN LACIRCULAR S-1.2, DEBIDAMENTE REQUISITADA Y FIRMADA, ESTA COMISION EMITIRA LA CEDULA DEAUTORIZACION EN UN PLAZO NO MAYOR DE 3 MESES, CONTADO A PARTIR DE LA RECEPCION DE DICHASOLICITUD. TRANSCURRIDO EL PRECITADO PLAZO, SE ENTENDERA LA RESOLUCION EN SENTIDOPOSITIVO.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    APROBACION DEL EXAMEN ANTE LA C.N.S.F. NIVEL I

    Del 60% al 79%De aciertos del total de reactivos

    formulados.

    1. El participante deber obtener el nivel I( rango de 60 a 79%) de evaluacin parahacerse acreedor de una cdula deautorizacin en el entendido de que tendr unperido mnimo de tres aos para acreditar unNivel II (rango de 80 a 100%) y lograr exentarla capacidad tcnica en forma indefinida.

    2. El participante que obtenga una calificacinmenor al 60% deber acreditar de nuevacuenta su capacidad tcnica.

    3. Para aqullos agentes que obtuvieron el nivelI de calificacion en todos los mdulossustentados, podrn mantenerse en el nivel I,si as lo determinan o bin reforzar sus areasde oportunidad para obtener el nivel II yexentar la capacidad tcnica, realizandoexclusivamente el trmite admistrativocorrespondiente.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT100

    NIVEL II

    Mnimo de 80%De aciertos del total de reactivos

    formulados.

    1. Para aqullos agentes que obtuvieron el nivelII de calificacin en cada uno de los mdulossustentados, se entender como exencin dela capacidad tcnica de manera indefinida,siempre y cuando se realice el refrendoadministrativo oportunamente.

    1. Aqullos agentes que obtengan niviel I en algunos de los mdulos y nivel II enotras, debern acreditar para el tramite de refrendo unicamente aqullos quecuentan con el nivel I., ya que los modulos de nivel II se encuentran exentos.

    2. A partir de su tercer refrendo solo requerirn hacer los tramites administrativos, noles ser requerido acreditar la capacidad tcnica.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SOLICITUD DE EXPEDICION DE CEDULA

    SOLICITUD PARA OBTENER UNA AUTORIZACION DEFINITIVA

    SOLICITUD PARA OBTENER UNA AUTORIZACION PROVISIONAL Art. 20 R.A.S.F.

    INSTITUCION C.N.S.F.

    LA INSTITUCION INTERESADA

    SOLICITARA COMISION NACIONAL DE

    SEGUROS Y DE FIANZAS

    A travs del formato FAS 1

    OFICIO DE AUTORIZACION

    Al da hbil siguiente de la

    solicitud

    La persona interesada enobtener una cdula comoagente o apoderado de seguros,deber solicitar a travs delformato FAS 2 la autorizacindefinitiva a la C.N.S.F El interesado deber

    La Institucin interesadapara utilizar sus servicios deun nuevo intermediario deseguros, deber solicitar atravs del formato FAS 1 laautorizacin provisional a laC.N.S.F., adjuntando losdocumentos requeridos en lacircular S-1.1 La C.N.S.F. Emitir eloficio de autorizacin al dahbil siguiente de la solicitud.

    INTERESADO C.N.S.F.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT101

    El interesado deberacreditar su capacidad tcnica atravs de un examen deconocimientos, o de lasconstancias que se encuentrenvigentes y que hayan sidootorgadas hasta el 31 de mayode 2003. Podrn sustentar losexmenes una o varias veceshasta acreditar su capacidadtcnica.Los exmenes se realizarnante la C.N.S.F., (oficinasCentrales y/o delegacionesregionales) y en el Centroaplicador de evaluacin. En laC.N.S.F. el costo del examenesta sujeto a lo establecido en laley federal de derechos vigente;pagado a travs de formatofiscal SAT-5, Y se sujetarn alos calendarios establecidos.En el Centro de aplicacin elcosto de recuperacin y elcalendario de exmenes loestablece el mismo. La C.N.S.F. emitir el oficiode autorizacin al da hbilsiguiente de la solicitud.

    LA PERSONA INTERESADA EN OBTENER UNA

    CEDULA

    SOLICITARA COMISION NACIONAL DE

    SEGUROS Y DE FIANZAS

    A travs del formato FAS 2

    EMITIRA EL OFICIO DE

    AUTORIZACION

    DEBERA SUSTENTAR SU

    CAPACIDAD TECNICA

    A travs un examende conocimientospagado a travs delformato SAT-5,

    Al da hbil siguiente de la

    solicitud

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SOLICITUD DE EXPEDICION DE CEDULA SOLICITUD PARA OBTENER REFRENDO DE CEDULA

    Los agentes que antesdel vencimiento de su cdulano hayan acreditado sucapacidad tcnica perderansu autorizacin, y podrniniciar los tramites paraobtener una nueva.Sustentar un examen deconocimientos, o

    Podrn sustentar losexmenes una o variasveces hasta acreditar sucapacidad tcnica(indefinidamente, durante ellapso de vigencia de lacdula). Los exmenes serealizarn ante la C.N.S.F.,(oficinas Centrales y/odelegaciones regionales) yen el Centro aplicador de

    AGENTE C.N.S.F.

    EL AGENTEANTES DEL

    VENCIMIENTO DE SU CEDULA

    SOLICITARA COMISION NACIONAL DE

    SEGUROS Y DE FIANZAS

    SUSTENTACION DEL EXAMEN

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    CCCC

    CCCCGGGGCTCTCTCTTTTT102

    en el Centro aplicador deevaluacin. En la C.N.S.F. elcosto del examen esta sujetoa lo establecido en la leyfederal de derechos vigente;pagado a travs de formatofiscal SAT-5, Y se sujetarna los calendariosestablecidos. En el Centrode aplicacin el costo derecuperacin y el calendariode exmenes lo establece elmismo.

    La C.N.S.F. emitir eloficio de autorizacin al dahbil siguiente de la solicitud. C.N.S.F.

    Emitir el oficio de autorizacin,

    al da hbil siguiente de la

    solicitud

    DEL EXAMEN

    ANTE LA C.N.S.F. (OFICINASCENTRALES Y/O REGIONALES,

    CENTRO APLICADOR DEEVALUACION (AUTORIZADOPOR LA C.N.S.F.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT103

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RELACIN ENTRE LAS TABLA DE

    MORTALIDAD Y EL CLCULO DEL

    COSTO DEL SEGURO

    Uno de los principios sobre los que se fundamenta el Seguro de Vida es que el nmerode muertes que pueden ocurrir, en un grupo suficientemente numeroso de personas,est sometido a las leyes de probabilidad, lo que permite establecer bases de clculo,permitiendo a las compaas de seguros fijar las primas correspondientes a sus planesde Seguro de Vida.

    Es un instrumento que aporta informacin estadstica sobre larelacin que existe sobre las posiblidades de fallecimiento adeterminada edad, cuya informacin se obtiene de experienciaspasadas.

    EDAD NUM. DE SOBREVIVIENTESAL INICIAR EL AO

    NUM. DEFALLECIMIENTOS

    PRIMA PURA DE RIESGO POR CADA

    $1,000 DE S.A.

    25 9575,636 18,481 1.93

    26 9557,155 18,732 1.96

    27 9538,423 18,981 2.00

    Revisemos el procedimiento bsico que se sigue para determinar el monto del lasprimas:

    TABLAS DE MORTALIDAD

    IV.1 BASES TECNICAS (Vida Individual)TABLAS DE MORTALIDAD COSTO DEL SEGUROTIPOS DE PRIMASDESCUENTOS/RECARGOSVALORES GARANTIZADOSDESIGNAC. DE BENEFiC.DIVIDENDOS

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT104

    27 9538,423 18,981 2.00

    28 9519,442 19,324 2.03

    29 9500,118 19,760 2.08

    30 9480,358 20,193 2.13

    TASA DE MORTALIDAD =

    NUMERO DE FALLECIMIENTOS

    NUMERO DE VIVOS X 1,000

    TASA DE MORTALIDAD =

    20,193

    9,480,358= 2.1

    A EDAD 30 AOS

    Es la contribucin de cada uno de los asegurados para resarcir lasperdidas econmicas resultantes en el grupo de los fallecimientosocurridos.

    COSTODEL SEGURO

    Es el elemento ms importante de la tabla demortalidad, pues se toma como base paradeterminar el costo del seguro.

    TASA DE MORTALIDAD

    Si se observa el rengln correspondiente a la edad 30 aos, se ve que de una poblacin inicial de9480,358, en un ao fallecen 20,193 personas.Dividiendo el nmero de personas fallecidas al final del ao entre el nmero de personas vivas alinicio del ao, se obtiene la Tasa de Mortalidad, esto es:

    2.1 por mil significa que de cada 1,000 personas de edad 30, es probable que mueran mas de dos enun ao

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Es la cantidad que paga el asegurado para tener derecho a laproteccin y sirve para que la aseguradora pueda cubrir; susobligaciones contractuales, los gastos de adquisicin, losgastos de administracin y la utilidad esperada

    TIPOS DE PRIMAS

    Existen diferentes clases de primas: PURA DE RIESGO, NATURAL ASCENDENTE, NIVELADA, NETA NIVELADA, TARIFA

    Recordemos cual es el concepto de PRIMA

    1.- PRIMA RIESGO

    4.- PRIMA DE AHORRO

    3.- PRIMA NETA NIVELADA

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT105

    PRIMA PURA DE RIESGO

    Est basada exclusivamente en la tabla de mortalidad y se calcula ao con ao a la edadalcanzada por el asegurado, para cubrir nicamente los costos de mortalidad. En estaforma, conforme pasa el tiempo y aumenta la edad del asegurado, el costo del riesgo seincrementa.Para obtenerla se multiplica la suma asegurada por el nmero de fallecimientos esperados en elao, y el resultado se divide entre el total de asegurados al principio del ao.

    ES IGUAL A

    Suma Asegurada X Fallecimientos esperados Total inicial de Asegurados

    1000 x 193 = 1.93100,000

    o sea, que si cada uno de los 100,000 asegurados aporta $1.93, obtendremos$193,000 con lo cual se pagarn los 193 siniestros que ocurrirn ese ao.

    EDAD:

    Suma Asegurada:Fallecimientos Esperados:

    25 aos$1,000.00193100,000

    Totales de Asegurados Apliquemos la frmula:

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    PRIMA NATURAL ASCENDENTE

    Se calcula ao con ao a la edad alcanzada por el asegurado yque va creciendo al aumentar la probabilidad de muerte.

    Obviamente, no sera posible aplicar en la prctica el sistema de la prima naturalascendente, ya que a la larga origina un costo muy elevado para el asegurado, queprovocara desercin de las personas aseguradas, a edad avanzada.

    Se obtiene al promediar las diferentes primas puras de riesgoSe obtiene al promediar las diferentes primas puras de riesgo.

    ejemplo: una persona de edad 25, en un plan a 5 aos con una suma asegurada de $100,000.00AOS DE VIGENCIA

    PRIMA TOTALPRIMA NIVELADA =

    AO EDAD PRIM NAT ASC

    12345

    2526272829

    193.00196.00200.00203.00208.00

    Es evidente que la probabilidad de muerte aumenta con la edad.

    PRIMA NIVELADA

    Es la que se mantiene constante durante todo el plazo del seguro yse obtiene al promediar las diferentes primas puras de riesgo

    PNPNN

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT106

    PRIMA NETA NIVELADA

    Son los gastos generales de la Compaaderivados de su funcionamiento: renta,telfono, sueldos del personal, papelera,equipo, etc.

    GASTOS DE ADMINISTRACION

    Son los gastos inherentes a la contratacin delas plizas: comisiones de los agentes,publicidad, exmenes mdicos, etc.

    GASTOS DE ADQUISICION

    Al incluir estos gastos, ms la utilidad esperada por la compaa, obtenemos la PRIMA DE TARIFA. PN = Prima Neta Nivelada

    GA = Gastos de administracinGAD = Gastos de adquisiscinU = Utilidad

    PRIMA DE TARIFA = PN + GA + GAD + U

    PRIMA DE TARIFA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    PRIMA DE AHORRO

    Funciona de manera inversa a la prima de riesgo, ya que al principio se cobrauna cantidad mayor y al paso del tiempo disminuye, equilibrando as el costo delseguro.

    30 AOS

    PRIMA DE AHORRO $100PRIMA DE RIESGO $ 50

    Es el valor econmico, en el momento de emitirse la pliza, que tiene el conjuntode obligaciones que asume el Asegurador, o en otras palabras, la prima total quepagara el asegurado por nica vez para poder contar con la cobertura establecida,no habiendo primas posteriores a sta.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT107

    La prima de tarifa multiplicada por la suma asegurada nos determina la primaneta. Finalmente a dicha prima neta se suma: recargo por pago fraccionado (si lohubiera) y un recargo fijo, esto refleja la prima total o definitiva que nuestroasegurado tendr que pagar anualmente.

    Este tipo de prima no es muy comn y tiene como caracterstica principal quedisminuye su importe a medida que pasa el tiempo. Propia de determinadasmodalidades de ahorro en Seguros de Vida, al aumentar la edad delAsegurado, disminuye la probabilidad de vida y en consecuencia laprobabilidad de hacer efectiva la indemnizacin prevista

    Costo adicional que la compaa de seguros cobra al asegurado, cuando el riesgoes mayor al normal.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RESERVA MATEMATICA

    Al pagar a travs de la Prima Nivelada hay excedentes durante los primeros aos devigencia de la pliza, ms los rendimientos obtenidos por su inversin, que seacumulan en un fondo llamado Reserva Matemtica.La reserva matemtica sirve para cubrir la diferencia en primas que durante losltimos aos deja de cobrar, porque la prima nivelada ser entonces ms baja que loscostos de mortalidad respectivos.

    PRIMA NIVELADA

    SE CREAN RESERVAS

    SE CONSUMEN RESERVAS

    Son las primas excedentes que se pagan durante los primeros aos de la pliza, mas rendimientos obtenidos

    por su inversin acumulados en un fondo.

    Solo en caso del seguro temporal con duracin menor de 10 aos, no obligara la aseguradora a conceder Valores Garantizados para el caso de muerte.(Art. 184 L.S.C.S.)

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT108

    VALORES GARANTIZADOS

    En principio queremos definir el Trmino > como las cantidades dedinero que la pliza del Asegurado va generando con el paso de los aos; y elTrmino >, porque no esta sujeto a las polticas de lasaseguradoras el concederlos o no, sino que est regulado en la Ley Sobre elContrato de Seguros, en su artculo 182 que establece lo siguiente:

    .

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    VALORES GARANTIZADOS

    En el seguro de vida individual slo otorgan Valores Garantizados a partir de quehan transcurrido tres anualidades completas y se han cubierto las primasrespectivas, en virtud de que durante los primeros aos se generan fuertes gastosde adquisicin y administracin, como el pago de comisiones, exmenes mdicos,gastos de expedicin.Del tercer ao en adelante las Compaas de Seguros tienen menos gastos,por lo que estn en posibilidades de ofrecer los valores garantizados a losasegurados; stos se pueden utilizar de las siguientes formas:

    Recibe parte de sus reservas en forma de prstamo

    En el PRESTAMO el asegurado recibe en efectivo todo o parte de sureserva, de acuerdo a las siguientes opciones:

    EFECTIVO

    MAYOR PROTECCION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT109

    Recibe parte de sus reservas en forma de prstamocon la tasa de inters equivalente a la que obtendra lacompaa, (para los fines que desee el asegurado)

    Se utiliza para cubrir el pago de algunas primassubsecuentes que el asegurado dejare de cubrir.

    Cuando el Asegurado decide suspender el pago de primas, el valor de rescate se puedeutilizar para pagar una cobertura de prima nica por el mismo plazo que contratoriginalmente, pero con menor suma asegurada.

    El Asegurado deja de pagar primas y utiliza el monto del rescate como pago nico,conservando la misma suma asegurada pero con un plazo menor al originalmentecontratado.

    Se aplica cuando el asegurado decide no continuar con su programa de seguro. Recibe en efectivo eltotal de la reservas acumuladas a su favor, esto implica la cancelacin de la pliza, cesando en esemomento los efectos de proteccin del contrato

    Segu

    ro pr

    orr

    oga

    do

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Supervit que las compaas acostumbran compartir con susasegurados, proporcionalmente a las primas cubiertas por cadauno de ellos. Esta participacin que otorgan las compaasrecibe el nombre de Dividendos.

    Dependiendo del tipo de plan contratado, y de las polticas de cada aseguradora, los

    DIVIDENDOS

    GASTOS

    MORTALIDAD

    RENDIMIENTOS

    DIVIDENDOS

    RENDIMIENTOS

    MORTALIDAD

    GASTOS

    PRESUPUESTADO REAL

    Sana mortalidad

    Rendimiento Financiero

    Reduccin en el gasto

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT110

    Dependiendo del tipo de plan contratado, y de las polticas de cada aseguradora, losdividendos se podrn otorgar a partir del segundo o tercer ao de vigencia de la pliza.Una vez que el asegurado adquiere el derecho de recibir los Dividendos, podr cobrarlosutilizando alguna de las siguientes opciones:

    1.- Aplicar el dividendo como parte del pago de primas

    2.- Dejar el dividendo en un fondo.

    3.- Retirar el dividendo anualmente

    1.- Seguro Prorrogado

    2.- Seguro saldado

    BENEFICIOS DE LOS

    DIVIDENDOS

    EN EFECTIVO

    COMPRA DE PROTECCION

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    IndisputabilidadEste contrato ser indisputable desde elmomento en que cumpla dos aos de estaren vigor, contados a partir de su fecha deinicio de vigencia o la de su ltimarehabilitacin y al efecto la compaarenuncia a los derechos que le asisten pararescindirlo en los casos de omisin o deinexacta declaracin al describir el riesgo enla solicitud del seguro.

    Cambio de Plan

    El contratante del seguro tendr derecho aconvertir este seguro a otra cobertura queemita la compaa, sin necesidad depruebas de asegurabilidad.

    INICIO DE VIGENCIA O ULTIMA REHABILITACION

    2 AOSLa compaa renuncia a los derechos que leasisten para:

    Rescindirlo en los casos de omisin o deinexacta declaracin al describir el riesgo en lasolicitud del seguro.

    CAMBIO DE PLAN

    VI.2 CONDICIONES GENERALES DE LA POLIZAINDISPUTABILIDADBENEFICIOS, CAMBIO DE PLANSEGURO DE MENORES, CARENCIA DE RESTRICCIONES, CONTENIDO DE LA POLIZARESCISION DE CONTRATO.

    De los elementos que conforman el contrato del seguro, la pliza (condicionesgenerales), es fundamental en ella se establecen los derechos y obligaciones para elasegurado y para la compaa.Revisaremos las ms relevantes:

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT111

    pruebas de asegurabilidad.La conversin de cobertura queda sujeta a

    lo que se estipula a continuacin:La solicitud correspondiente deber serrecibida por la compaa al menos dos aosantes de la terminacin del plazo delseguro.La edad alcanzada por el asegurado almomento del cambio no podr ser superiora 70 aos.La nueva cobertura ser efectiva a partirde la misma fecha en que cese la coberturaanterior.La nueva suma asegurada no podr sersuperior a la correspondiente del seguroanterior, salvo que el asegurado hayapresentado a la compaa pruebas deasegurabilidad y sta las haya aceptado.La prima se calcular de acuerdo con laedad alcanzada por el asegurado en lafecha en que se lleve a cabo la conversin,incluyendo cualquier extraprima por salud uocupacin que la pliza original hubieratenido, y en caso de incremento en la sumaasegurada, los requisitos de asegurabilidaddeterminaran o reconsideraran alguna, sedeber tomar en cuenta en dicho clculo.

    PLAN A PLAN B

    SIN NECESIDAD DE PRUEBAS DE ASEGURABILIDAD SIEMPRE Y CUANDO:

    PODR SER CAMBIADO EN CUALQUIER MOMENTO POREL ASEGURADO. A OTRO QUE TENGA LA INSTITUCIN .

    LA POLIZA ORIGINAL ESTE EN VIGOR Y LA EDAD DELASEGURADO NO PODRA SER MAYOR DE 70 AOS

    LA NUEVA COBERTURA ENTRARA EN VIGOR EN EL MISMOMOMENTO QUE LA OTRA CESE

    LA SUMA ASEGURADA SERA IGUAL AL PLAN ORIGINAL.(SALVO QUE EL ASEGURADO PRESENTE Y SEANACEPTADAS LAS PRUEBAS DE ASEGURABILIDAD)

    LA PRIMA SERA CALCULADA DE ACUERDO A LA EDADALCANZADA DEL ASEGURADO AL MOMENTO DEL CAMBIO.El importe del cambio queda a cargo del asegurado

    SUMA ASEGURADA SERA IGUAL

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Seguro de menoresLas condiciones de contratacin y clusulas

    se modifican para asegurados menores dedoce aos de edad, en los siguientestrminos:A partir de la fecha en que el menor cumplalos doce aos de edad entrar en vigor elseguro para el caso de fallecimiento y alocurrir ste se liquidar la suma aseguradacontratada a los beneficiarios designadosconforme a la clusula Pago del Seguro.El plazo de los dos aos a que se refierenlas clusulas de indisputabilidad y suicidio secontar a partir de la fecha en que el menorcumpla los doce aos de edad.En caso de que el contratante falleciereantes de la terminacin de la vigencia de lapliza y siempre y cuando el asegurado tengacumplidos 18 aos de edad, ste tendrderecho al valor de rescate correspondiente.Si a la muerte del contratante el asegurado esmenor de 18 aos, quien ejercer losderechos sobre el valor de rescate ser elrepresentante legal del asegurado.

    Carencia de Restricciones

    Este contrato de seguro no estar sujeto arestriccin alguna, ya sea en atencin algnero de vida, residencia, ocupacin o viajes

    ASEGURADOS MENORES DE 12 AOS

    CONTRATO DE

    En caso de fallecimiento del asegurado menor de 12

    aos

    La compaa pagar a losbeneficiarios designados el importe delas primas cubiertas o el valor derescate, lo que resulte ser mayor.

    Hasta que el menor cumpla 12 aos

    Llas clusulas de indisputabilidad ysuicidio se contar a partir de la fecha enque el menor cumpla los doce aos deedad.

    A partir de los 12 aosEn caso de que el contratante falleciere antes de la vigencia de la pliza y el asegurado tenga cumplidos 18 aos de edad, ste tendr derecho al valor de rescate correspondiente. (Va su represent.ante)

    SEGURO DE MENORESEste seguro crea un fondo de ahorro que ayuda a solventar los gastos de educacin extraordinarios que surjan en la vida del menor, en caso de

    fallecimiento de sus padres

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT112

    restriccin alguna, ya sea en atencin algnero de vida, residencia, ocupacin o viajesdel asegurado.

    Contenido de la Pliza (Art. 153 LSCS)

    La Empresa Aseguradora estar obligada aentregar al contratante del seguro, una plizaen la que consten los derechos y obligacionesde las partes. La pliza deber contener:I.Los nombres, domicilios de los contratantesy firma de la empresa aseguradora;II.La designacin de la cosa o personaasegurada;III.La naturaleza de los riesgos garantizados;IV.El momento a partir del cual se garantiza elriesgo y la duracin de esta garanta;V.El monto de la garanta;VI.La cuota o prima del seguro, yVII.Las de ms clusulas que deban figuraren la pliza de acuerdo con las disposicioneslegales, as como las convenidas lcitamentepor los contratantes.

    CONTRATO DE SEGUROS Este contrato no est sujeto a

    restriccin alguna, ya sea enatencin al gnero de vida,residencia, viajes u ocupacin delasegurado

    POLIZA, EL DOCUMENTO QUE ESTABLECE DERECHOS Y

    OBLIGACIONES DE LAS PARTES

    I. Los nombres, domicilios de los contratantes y firma de laempresa aseguradora;

    II. La designacin de la cosa o persona asegurada;III. La naturaleza de los riesgos garantizados;IV. El momento a partir del cual se garantiza el riesgo y la

    duracin de esta garanta;V. El monto de la garanta;VI. La cuota o prima del seguro

    Si el contenido de la pliza no concordar con la oferta o sus modificaciones, elasegurado podr pedir su rectificacin, dentro de los 30 das de recibida lapliza. Transcurrido el plazo, se considerarn aceptadas las estipulaciones de lapliza o sus modificaciones

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Rescisin de Contrato por Omisioneso Inexactas Declaraciones

    El contratante y el asegurado al formular lapropuesta del seguro estn obligados adeclarar por escrito a la compaa, mediantelos cuestionarios relativos, todos los hechosimportantes, para la apreciacin del riesgoque puedan influir en las condicionesconvenidas, tal como los conozca(n) odeba(n) conocer en el momento de lacelebracin del contrato.

    La omisin o inexacta declaracin de loshechos importantes a que se refiere el prrafoanterior, facultar a la compaa paraconsiderar rescindido de pleno derecho elcontrato, an cuando stos no hayan influidoen la realizacin del siniestro.

    PRESCRIPCIONEn el sentido que se usa en la Ley sobre el

    EL CONTRATANTE EL ASEGURADO

    A QUE ESTAN OBLIGADOS AL FORMULAR LA PROPUESTA DEL SEGURO?

    A DECLARAR TODOS LOS HECHOS IMPORTANTES PARA LA APRECIACION DE RIESGO QUE PUEDAN INFLUIR EN LAS

    CONDICIONES CONVENiDAS TAL COMO LAS CONOZCA O DEBA CONOCER.

    OMISION O INEXACTA DECLARACION DE LOS HECHOS FACULTARA A LA COMPAA

    ASEGURADORA PARA:

    Rescindido de pleno derecho el contrato, an cuando stos no hayan influido en la realizacin

    del siniestro.

    TRANSCURRIDOS DOS AOS LA COMPAA NO

    CUESTIONARA EL ORIGEN DEL SINIESTRO

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT113

    En el sentido que se usa en la Ley sobre elcontrato de seguro PRESCIPCION: Significaun medio para liberarse de obligaciones, porno exigirse su cumplimiento dentro de uncierto tiempo establecido por la ley (art.1135 y1136 del Cdigo Civil para el D.F.)Esto significa que la Aseguradora quedarliberada de las obligaciones si no se le exigesu cumplimiento en el trmino de dos aos,contando desde la fecha del acontecimientoque les di orgen.Tratandose de la realizacin del siniestro, elplazo se cuenta desde que los interesados seenteran de la realizacin del siniestro y delderecho que exste a su favor bajo la pliza.La prescripcin se interrumpe por elnombramiento de peritos por el escrito dequejas presentado ante la Condusef en lostrminos del art. 135 bis y 136 de la LGISM.

    EDAD. Cuando se compruebe que huboinexactitud en la indicacin de la edad delasegurado, la empresa no podr rescindir elcontrato, a no ser que la edad real al tiempode su celebracin, est fuera de los lmites deadmisin fijados por la empresa, pero en estecaso se devolver al asegurado la reservamatemtica del contrato en la fecha de su

    rescicin

    PRESCRIBIRN EN DOS AOS

    EN TRMINOS GENERALES, EN QU TIEMPO PRESCRIBEN LAS ACCIONES QUE SE DERIVAN DE UN CONTRATO DE

    SEGUROS?

    Tratandose de la realizacin del siniestro, elplazo se cuenta, desde el da en que hayallegado a conocimiento de los interesados,quienes debern demostrar que hastaentonces ignoraban dicho derecho.

    CUANDO LA EDAD DEL ASEGURADO FUE DECLARADA INEXACTAMENTE Y ESTA SE ENCUENTRA FUERA DE LOS

    LMITES DE ADMISIN QU OBLIGACIN ASUME LA INSTITUCIN ANTE EL ASEGURADO?

    DEVOLVER LA RESERVA MATEMTICADEL CONTRATO EN LA FECHA DE RESCISIN

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    La perdida de la vida de una persona esirreparable, y causa generalmente una profundapena a sus seres queridos, en la que difcilmentepuede darse ayuda; no obstante este problemaemocional, puede verse complicado con un graveproblema econmico, si resulta que la personafallecida era el sostn econmico de dicha familia, opor lo menos parte importante en la consecucin desu nivel de vida, por alto o bajo que este sea.Algo similar sucedera, si la persona no muere sino

    queda invlida, de hecho este ltimo caso serapeor, por lo menos en lo econmico, ya que elinvlido no slo no aportara dinero al ingresofamiliar, sino que se convertira en una carga paralos dems.El lograr que la familia cuente con los elementos

    necesarios para mantenerse de manera similar apesar de la muerte o invalidez de aquella personadesaparecida, por lo menos temporalmente en loque encuentran otro modus vivendi es el objeto delseguro de vida. Por lo tanto podramos definirlo de lasiguiente manera:El seguro de vida es un instrumento financiero

    cuya finalidad es prolongar la vida econmica deun individuo cuando ha sido suspendida a causa

    OBJETO DEL SEGURO

    RIESGO

    SEGURO DE DAOS

    SEGURO DE VIDA

    OBJETO DEL SEGURO DE DAOSQue el asegurado al perder un bienprotegido por una pliza de seguroobtenga los medios necesarios parareponer aquel bien perdido.

    Causa generalmente una profunda pena a susseres queridos, no obstante este problemaemocional, puede verse complicado con ungrave problema econmico, si resulta quela persona fallecida era el sostneconmico de dicha familia, o por lo menosparte importante en la consecucin de sunivel de vida, por alto o bajo que este sea.

    Si la persona no muere sinoqueda invlida, de hecho esteltimo caso sera peor, por lomenos en lo econmico, ya queel invlido no slo no aportaradinero al ingreso familiar, sinoque se convertira en una cargapara los dems

    VI.3 TIPOS DE PLANESPlanes basicosOpciones de inversionFondos de inversionfideicomisos

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT114

    un individuo cuando ha sido suspendida a causade su muerte o su invalidez.Podemos deducir de la anterior definicin que el

    seguro de vida, si protege la vida; la vida productiva,econmicamente, hablando de los asegurados. Esobvio que la vida productiva de la que hablamos,existe desde el momento en que el individuo obtieneingresos por su trabajo personal. Cabe mencionarque el propio individuo depende econmicamente dedicho trabajo en la mayora de las ocasiones.

    TIPOS DE NECESIDADES QUECUBRE EL SEGURO DE VIDA:

    Ahora bien hay que aclarar que las personas notienen el mismo tipo de necesidades econmicasdurante toda su vida, sino que stas van variando enel transcurso de la misma, por ejemplo, un nio nogasta la misma cantidad de dinero que un joven, queun adulto, o que un anciano. Estos gastos sonmucho ms altos en ciertas etapas de su existencia,como cuando se casa y tiene hijos, cuando y estosestudian; posteriormente vuelve a disminuir cuandolos hijos crecen y se vuelven personas productivas,es decir, dejan de ser sus dependientes econmicos.

    Un ciclo similar lo podemos observar en lacapacidad productiva de hombres y mujeres; cuandoson nios dependen absolutamente de sus padres,pues no producen ingresos; durante su juventud ymadurez se vuelven productivos gracias a su trabajo;esta productividad puede decaer o prcticamentedesaparecer durante la vejez.

    OBJETO DEL SEGURO DE VIDAEl lograr que la familia cuente con los elementos necesarios paramantenerse de manera similar a pesar de la muerte o invalidez de aquellapersona desaparecida, por lo menos temporalmente en lo que encuentranotro modus vivendi.

    El seguro de vida es un instrumento financiero cuyafinalidad es prolongar la vida econmica de unindividuo cuando ha sido suspendida a causa de sumuerte o su invalidez.

    CICLO DE VIDA ECONOMICO DE UNA PERSONA

    I ETAPAI ETAPAECONOMICAMENECONOMICAMENTE DEPENDIENTETE DEPENDIENTE

    II ETAPAII ETAPAECONOMICAMENECONOMICAMEN

    TE ACTIVOTE ACTIVO

    III ETAPAIII ETAPAECONOMICAMENECONOMICAMEN

    TE PASIVOTE PASIVO

    IV ETAPAIV ETAPAVIDA VIDA

    ECONOMICA ECONOMICA TRASCENDENTETRASCENDENTE

    ENFERMEDAD ENFERMEDAD ACCIDENTEACCIDENTEMUERTEMUERTE

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    De lo que hemos analizado en este captulopodemos deducir que las personas tienen lossiguientes riesgos, los cuales son necesariospreveer:-La muerte: natural o accidental- La invalidez: Fsica- La sobrevivencia:- Invalidez econmicaTambin hemos observado que estasnecesidades pueden tener una duracindiferente a lo largo de la vida, segn sea lacapacidad productiva y el tiempo en que sepodr desempear la misma, es decir:Necesidades temporales:-La educacin de los hijos- Cubrir la amortizacin de la casa.- La amortizacin de otros adeudos, etc.Necesidades permanentes:- La manutencin familiar- Gastos de su funeralNecesidades de sobrevivencia:- Jubilacin, retiro o pensin

    CLASIFICACION DE LAS NECESIDADES DEL SER HUMANO

    TEMPORALESAPARECEN NICAMENTE DURANTE CIERTO

    PERIODO DE LA VIDA

    PERMANENTES O VITALICIAS

    SE MANTIENEN TODA LA VIDA

    SOBREVIVENCIAAL DISMINUIR LA CAPACIDAD PRODUCTIVA DEL

    INDIVIDUO

    PLANES BASICOS DEL SEGURO DE VIDA INDIVIDUAL:

    Si las necesidades de proteccin sondiferentes en las distintas etapas de la vida, y

    El asegurado se compromete alpago de primas durante untiempo estipulado en la pliza, laInstitucin se obliga a pagar lasuma asegurada a losbeneficiarios si el aseguradofallece dentro de la vigencia dela pliza contratada, al terminoterminan los compromisos porambas partes.

    Cubre al asegurado

    Dan origen

    QU CUBREN LOS PLANES BASICOS?

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT115

    diferentes en las distintas etapas de la vida, yadems difieren entre las distintas personas,es imperioso que las compaasaseguradoras cuenten con los planesadecuados para cubrir esas necesidades, porello se crearon los siguientes planes bsicos:

    - Planes Temporales.- Cubre alasegurado durante un tiempo determinado yse paga durante el mismo plazo, como sunombre lo indica estos planes se identificancon las necesidades temporales de laspersonas. En caso de que la muerte delasegurado no sobrevenga durante el plazocontratado, cesan todos las obligaciones de laaseguradora.- Planes de Vida Entera.- El asegurado

    estar protegido desde el momento de sucontratacin hasta que ocurra su muerte, elmas comn es el llamado Ordinario deVida durante este tiempo deber pagar lasprimas respectivas. Estos planes seidentifican con las necesidades permanentesdel individuo.

    Existen algunos mecanismos para que sepague solo un nmero determinado de aos,sin menoscabo de la proteccin vitalicia,mediante primas ms elevadas quefinanciarn las primas futuras, estos planes sellaman Vida pagos limitados.- Planes Dotales.- Este plan se creo para

    cubrir las necesidades de sobrevivencia,puesto que si la muerte no ocurre durante lavigencia de la pliza, caso en el cual sepagara la suma asegurada a los beneficiariosdesignados, la compaa aseguradora seobliga a pagar dicha suma asegurada alpropio asegurado, este pago se llama dote.

    PLANES BASICOS

    VIDA ENTERA

    El asegurado estarprotegido desde elmomento de sucontratacin hastaque ocurra sumuerte

    Cubre al aseguradodurante toda su vida yeste paga durante elmismo plazo. Si elasegurado sobrevive a los99 aos (muerte tcnica) yse le paga a el la sumaasegurada.

    Cubre al aseguradodurante toda su vida yeste paga durante elplazo contratado. Si elasegurado sobrevive a los99 aos (muerte tcnica) yse le paga a el la sumaasegurada.

    Cubre las necesidades desobrevivencia, puesto que si lamuerte no ocurre durante lavigencia de la pliza, caso en elcual se pagara la suma aseguradaa los beneficiarios designados, lacompaa aseguradora se obliga apagar dicha suma asegurada alpropio asegurado, este pago sellama dote.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Con el correr de los aos, estos planes bsicos hansido promocionados en diferentes versiones y plazospara contar con una gama ms amplia deposibilidades que garanticen el poder cubrir lasnecesidades de aseguramiento especifico de cadapersona; en el cuadro que se presenta acontinuacin se describen dichos planes y sedetallan sus diferentes plazos:

    OPCIONES DE INVERSIN Y ADMINISTRACIN EN EL SEGURODE VIDA Considerando las condiciones econmicas actuales

    a nivel nacional e internacional se hace cada vezms necesario planear el presente y futuroeconmicos de nuestras familias. Con esta premisasurgen esquemas en el seguro de vida que proveenla posibilidad de aportar una cantidad adicional a laprima del seguro de vida con la finalidad de invertirseen instrumentos del mercado de dinero o decapitales.La compaa de seguros est autorizada paraadministrar valores en efectivo propiedad delasegurado provenientes de dividendos y/o dotales a

    VERSIONES EN QUE SE PROMOCIONANLOS PLANES BSICOS

    O.V.

    V.P.L.

    T.

    D.

    PLANES BASICOS

    Una gama ms ampliade posibilidades quegaranticen el podercubrir las necesidadesde aseguramientoespecifico de cadapersona

    ESQUEMAS DE INVERSION EN EL SEGURO DE VIDA

    EL ASEGURADO PAGA UNA PRIMA

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT116

    asegurado provenientes de dividendos y/o dotales acorto plazo. Dichos valores en administracinconstituyen el fondo de inversin.Este fondo generar intereses segn la tasa derendimiento obtenida por la compaa en susinversiones. Dichos intereses se calcularn yabonarn al cierre de cada mes considerando elperodo real en que los abonos ingresaron alfondo de inversin.

    Al aniversario de la pliza la compaa deducirun porcentaje sobre el fondo acumulado, porconcepto de gastos de administracin.

    El fondo de inversin del asegurado formarparte de la liquidacin que haga la compaa alasegurado en caso de cancelarse la pliza o, dela liquidacin que haga a los beneficiariosdesignados si ocurre el fallecimiento delasegurado o al trmino de la vigencia del plan.

    Dicho fondo se apegar a las reglas para lainversin de las reservas tcnicas de lasInstituciones y Sociedades Mutualistas deSeguros, emitidas por la SHCP (Diario Oficial dela Federacin del 18 de agosto del 2000).

    Otra manera de invertir los excedentes de primasera a travs de Fideicomisos, los cualesgarantizan al asegurado que una vez que l lodetermine; el capital e intereses acumulados sedestinarn exclusivamente en los trminos ycondiciones previamente determinados por lmismo.

    CON LA`POSIBIIDAD DE APORTAR

    UNA CANTIDAD ADICIONAL A LA

    PRIMA DEL SEGURO

    FONDO DE INVERSION

    INTERESES

    FONDO DE INVERSION

    FORMARA PARTE DE LA LIQUIDACIONQUE HAGA LA ASEGURADORA A FAVORDEL ASEGURADO EN CASO DECANCELARSE LA POLIZA,

    FORMARA PARTE DE LA LIQUIDACIONQUE HAGA LA ASEGURADORA A FAVORDEL BENEFICIARIO EN CASO DEFALLECIMIENTO EL ASEGURADO.

    OTRA FORMA ES ATRAVES DE UNFIDEICOMISO.

    Figura que sin tenerpersonalidad jurdica tienecomo objeto la adquisicin,tenencia, disfrute,administracin de valoresmobiliarios, cotizados en bolsa,para compensar la inversin desus activos, riesgos ydiferentes rendimientos de lasinversiones efectuadas

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Como recordarn, antes mencionamos queadems de la muerte y la sobrevivencia, lascuales ya vimos como se pueden cubrir, loshombres y mujeres tienen el riesgo deInvalidez, y adems que dichos riesgospueden sufrirse a consecuencia de unaenfermedad o incrementarse aconsecuencia de un accidente, para cubrirestas eventualidades y algunas otras secrearon los Beneficios adicionales.Estos son protecciones que se agregan ycomplementan a alguno de los planesbsicos, pero que tienen ciertascaractersticas propias:- Son opcionales para el cliente.- Se contratan de manera adicional.- Cada uno tiene sus propias condicionesparticulares.- Siempre son disputables:- La suma asegurada puede ser igual omenor a la de la cobertura bsica, peronunca mayor a esta.

    VI.4 BENEFICIOS ADICIONALES

    RIESGOS ASEGURABLES DE LAS PERSONAS

    Estos riesgos pueden sufrirse a consecuencia de unaenfermedad o incrementarse a consecuencia de un accidente,para cubrir estas eventualidades y algunas otras se crearon:

    SOBREVIVENCIAINVALIDEZMUERTE

    COBERTURA QUE SE REFIEREN A RIESGOSQUE AMENAZAN AL INDIVIDUO, SIN QUENECESARIAMENTE IMPLIQUEN EL

    BENEFICIOS ADICIONALES

    Son coberturas que se agregan a un seguro de vida,ampliando y complementando la proteccin que este ofrece

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT117

    nunca mayor a esta.- No tienen derecho a valores garantizados.

    Los beneficios adicionales son los que acontinuacin se describen, en el cuadroanterior podemos encontrar su aplicacin encada tipo de plan:

    NECESARIAMENTE IMPLIQUEN ELFALLECIMIENTO,

    SON OPCIONALES PARA EL ASEGURADO SE CONTRATAN DE MANERA ADICIONAL A

    UNA COBERTURA BASICA CADA UNO TIENE SUS PROPIAS

    CONDICIONES PARTICULARES. SIEMPRE SON DISPUTABLES: CUENTAN CON SUMA ASEGURADA PROPIA,

    PUEDE SER IGUAL O MENOR A LA DE LACOBERTURA BSICA, PERO NUNCA MAYORA ESTA.

    POR SU NATURALEZA NO RECIBENTRATAMIENTOS ESPECIALES, NO CUENTANCON LAS COBERTURAS DE SUICIDIO,INDISPUTABILIDAD, CARENCIA DERESTRICCIONES.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LOS BENEFICIOSADICIONALES MASIMPORTANTES SON;

    BENEFICIOS ADICIONALES

    BENEFICIOS ADICIONALES

    MUERTE ACCIDENTAL

    PERDIDAS ORGANICAS (ACCIDENTE)

    ACCIDENTE COLECTIVO

    EXCENCCION DE PAGO DE PRIMAS

    INVALIDEZ TOTAL Y PERMANENTE

    RENTAS POR INVALIDEZ

    ANTICIPO DE SUMA

    ASEGURADA POR MUERTE

    ULTIMOS GASTOS

    La denominacin de estas coberturas puede variar de una aseguradora a otra, sinembargo, el funcionamiento es prcticamente el mismo, con ligeras variantesocasionales que obedecen a polticas internas.BENEFICIO POR

    ACCIDENTES

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT118

    Cubre el incremento deriesgos a causa deaccidentes

    BENEFICIO POR ACCIDENTE

    "Se entender por accidente aquelacontecimiento que produce lesiones oprdidas corporales, o la muerte misma, yque es provocado por una causa sbita,fortuita violenta y externa".

    Se pagarn las reclamaciones cuando lamuerte o la prdida orgnica a causa deun accidente hayan acaecido dentro delos noventa das siguientes a dichosuceso.

    A fin de evitar situaciones de dolo, mala fe, oconflictos de interpretacin se ha definido elconcepto de ACCIDENTE de la siguientemanera:

    EXCLUSIONES: Lesin causada intencionalmente Enfermedades, padecimientos o

    intervenciones quirrgicas de cualquiernaturaleza que no sean ocasionadasdirectamente por un accidente

    Envenenamientos Inhalacin de gases de cualquier clase,

    excepto cuando se deriven de unaccidente

    Suicidio o intento de l Homicidio intencional Rias, cuando el asegurado ha sido el

    provocador Servicio militar en tiempo de guerra,

    revolucin o actos de insurreccin Navegacin area salvo como pasajero

    de una compaa comercial de aviacinde itinerario regular

    Navegacin submarina Paracaidismo, motociclismo Participar directamente en pruebas,

    carreras o competencias de seguridad,resistencia o velocidad

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    BENEFICIOS POR ACCIDENTE

    Para efectos de esta clusula y suscoberturas solo se pagarn las reclamacionescuando la muerte o la prdida orgnica acausa de un accidente hayan acaecido dentrode los noventa das siguientes a dichosuceso.

    Sus coberturas son:- Doble indemnizacin por muerteaccidental.- Si la muerte ocurre a causa deun accidente, la compaa pagar la sumaasegurada contratada para esta clusula,adicionalmente a la suma asegurada por elbeneficio de Muerte.OPERACION:La Institucin pagar adicionalmente a losbeneficiarios, la suma asegurada contratadabajo este beneficio, en caso de que elasegurado fallezca a consecuencia de unaccidente amparado, dentro del plazo

    BENEFICIOS POR

    ACCIDENTE

    MUERTE POR ACCIDENTE

    LA COMPAA PAGAR:

    FALLECIMIENTO FALLECIMIENTO EN ACCIDENTE

    SUMA ASEGURADA SUMA ASEGURADA

    Muerte accidental amparada con una suma asegurada igual o inferior ala cobertura bsica

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT119

    accidente amparado, dentro del plazoestipuladoSUMA ASEGURADA:Igual o inferior a la cobertura bsicaPLAZO DE CONTRATACION:El mismo del plan principal, menorEDAD DE CONTRATACION:De 12 a 65 aosCONTRATACION:Este beneficio se podr contratarse solo oconjuntamente con el de prdidas orgnicas yel de accidente colectivo.CANCELACION:Este beneficio se cancelar al trmino de lacobertura principal o cuando el aseguradocumpla 70 aos.

    Plan igual o menor y edad de contratacin entre 12 y 65 aos Contratado slo o conjuntamente con el de prdidas orgnicas y el de

    accidente colectivo, el beneficio se cancela al trmino de la coberturaprincipal o cuando el asegurado cumpla 70 aos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    - Muerte Accidental Colectiva.- Lacompaa pagar la Suma Aseguradacontratada por este beneficio si la muertedel asegurado ocurre:

    1.- En cualquier vehculo impulsadomecnicamente de transporte pblico, queno sea areo, en el que viajare elasegurado en calidad de pasajero, o

    2.- A causa de un incendio en unteatro, hotel u otro edificio pblico en elcual se encontrare el asegurado almomento de iniciarse el incendio, o,

    3.- En algn ascensor destinado alservicio pblico en el cual viajare elasegurado, siempre y cuando no sea deminas, pozos petroleros, plataformasmarinas o similares.

    OPERACION:Este beneficio se contrata invariablementeen forma adicional a los beneficios demuerte accidental y de prdidas orgnicas.Con este beneficio, normalmente se

    BENEFICIOS ADICIONALES

    BENEFICIOS POR

    ACCIDENTE

    MUERTE ACCIDENTAL COLECTIVA

    LA COMPAA PAGAR:

    FALLECIMIENTO FALLECIMIENTO FALLECIMIENTO EN ACCIDENTE

    SUMA ASEGURADA SUMA ASEGURADA SUMA ASEGURADA

    Este beneficio se contrata invariablemente en forma adicional a los beneficiosde muerte accidental y de prdidas orgnicas.Con este beneficio, normalmente se duplica la indemnizacin de muerteaccidental o de prdidas orgnicas por accidente (depende de cadacompaa

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT120

    Con este beneficio, normalmente seduplica la indemnizacin de muerteaccidental o de prdidas orgnicas poraccidente (depende de cada compaa).

    AVISO DE SINIESTRO:El accidente deber notificarse a lacompaa, en un plazo mximo de 5 dasa partir de la fecha en que se tengaconocimiento del mismo, salvo causas defuerza mayor.

    FALLECIMIENTO EN ACCIDENTE EN ACCIDENTE

    COLECTIVO

    1.-En cualquier vehculo impulsado mecnicamente detransporte pblico, que no sea areo, en el que viajare elasegurado en calidad de pasajero, o

    2.- A causa de un incendio en un teatro, hotel u otro edificiopblico en el cual se encontrare el asegurado al momento deiniciarse el incendio, o,

    3.- En algn ascensor destinado al servicio pblico en elcual viajare el asegurado, siempre y cuando no sea de minas,pozos petroleros, plataformas marinas o similares.

    AVISO DEL SINIESTROEl accidente deber notificarse a la compaa, en un plazo mximo de 5das a partir de la fecha en que se tenga conocimiento del mismo, salvocausas de fuerza mayor.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    - PERDIDAS ORGANICASLa institucin pagar al asegurado unaindemnizacin cuando sufra una prdida deuna parte del cuerpo o bien pierda la funcindebido a un accidente amparado

    OPERACION:Bajo este beneficio la compaa pagar, alAsegurado, una indemnizacin cuando sufrala prdida de una parte del cuerpo o bienpierda la funcin, debido a un Accidenteamparado

    BENEFICIOS ADICIONALES

    BENEFICIOS POR

    ACCIDENTE

    Se pagar la porcin de la suma aseguradacontratada de acuerdo a la siguiente tabla:

    Por la muerte del asegurado 100 % Por la prdida de ambas manos o ambos pies o la vista de ambos ojos

    100 %

    Por la prdida de una mano y de un pie 100 % Por la prdida de una mano o un pie, conjuntamente con la vista de un ojo

    100 %

    Se considerar prdida de la vista, lafalta completa e irreparable de lavisin.

    Se considerar prdida de la mano,cuando exista separacin a partir delnivel de la mueca

    Se considerar prdida del pie,

    La Institucin pagar al asegurado una indemnizacin cuando sufra unaprdida de una parte del cuerpo o bien pierda la funcin debido a un accidenteamparado

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT121

    CANCELACION:Este beneficio se cancelar en el momentoque se utilice y se reciba cualquierindemnizacin. Tambin al concluir lacobertura principal, o cuando el aseguradocumpla 70 aos de edad.

    CONTRATACION:Este beneficio deber contratarseconjuntamente con el de muerte accidental.

    un ojo 100 % Por la prdida de una mano o un pie 50 % Por la prdida de la vista de un ojo 30 % Por la prdida de un dedo pulgar 15 % Por la prdida de un dedo ndice 10 % Por la prdida de cada uno de los dedos, medio, anular y meique 5 %

    cuando exista separacin a partir delnivel del tobillo

    Se considerar prdida de los dedos,cuando exista separacin de dosfalanges

    Algunas compaas cubren laanquilosis de manos y pies.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    BENEFICIOS POR INVALIDEZ.-

    Tal como sucedi con los beneficios poraccidente, antes de describir los que seotorgan para cubrir los riesgos deincapacidad o invalidez anotaremos ladefinicin de dicho estado:INVALIDEZ TOTAL Y PERMANENTEEs importante hacer la aclaracin que lacompaa solicitar pruebas de dichoestado de invalidez, y recordar que estosbeneficios, al igual que todos losbeneficios adicionales, tienen sus propiascondiciones de contratacin, los cualesincluyen un capitulo de exclusiones(riesgos no cubiertos).

    ORIGEN:La incapacidad debe tener como causaun accidente o una enfermedad.VERIFICACION:La Aseguradora tiene derecho acomprobar, a su satisfaccin que seprodujo el estado de incapacidad, de igual

    BENEFICIOS POR INVALIDEZ

    Cualquier lesin corporal a causa de un accidente ouna enfermedad que le impida al asegurado por unmnimo de seis meses continuos, el desempeo detotal las actividades propias de su trabajo habitual ocualquier otro apropiado a sus conocimientos,habilidades y compatibles con su posicin social,siempre y cuando se presuma que dicha imposibilidades de carcter permanente

    INVALIDEZ TOTAL Y PERMANENTE

    Deben transcurrir seis meses como perodo de esperapara que este beneficio comience a surtir efecto

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT122

    produjo el estado de incapacidad, de igualforma podr investigar que se mantengaen dicho estado.Si el asegurado se ha rehabilitado o leniega informacin a la compaa, cesarnlas obligaciones de staPERIODO DE ESPERA:Estos beneficios comenzarn a surtirefecto seis meses despus de que sehaya declarado la incapacidad total ypermanente.EDAD DE CONTRATACION:Entre los 16 y 55 aosCONTRATACION:Este beneficio podr contratarse solo oconjuntamente con el de prdidasorgnicas y el de accidente colectivo.CANCELACION:Este beneficio se cancelar al termino dela cobertura principal cuando elasegurado cumpla 60 aos.

    Podr contratarse solo conjuntamente con el de prdidasorgnicas y el de accidente colectivo

    Se cancelar al trmino de la cobertura principal cuandoel asegurado cumpla 60 aos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    BENEFICIO DE EXENCIN DE PAGO DE PRIMAS POR INVALIDEZ TOTAL Y PERMANENTESi el asegurado, a causa de una invalidez

    total y permanente, se ve imposibilitado parapagar el importe de sus primas, mediante estebeneficio la compaa pagar por el lasprimas que resten hasta que se cumpla elplazo contratado de seguro. Este beneficiotambin es conocido como "Exencin de pagode primas".OPERACION:La Institucin se obliga a mantener en vigorla pliza durante todo el plazo contratado, sinms pago de primas por parte del asegurado,si este llega a sufrir un estado de incapacidadtotal y permanente. De esta forma continadisfrutando de la proteccin considerando quequeda imposibilitado para seguir pagando lasprimas.SUMA ASEGURADA:Lo representa el importe de las primaspendientes de cubrir, por el perodo faltantede la vigencia contratada.PERIODO DE COBERTURA:Desde que concluye el perodo de esperahasta la terminacin del plazo de vigencia dela pliza contratada.

    BENEFICIOS POR INVALIDEZ

    INVALIDEZ TOTAL Y PERMANENTE

    BENEFICIO DE EXENCION DE PAGO DE PRIMAS POR INVALIDEZ TOTAL Y PERMANENTE

    SI EL ASEGURADO QUEDA EN ESTADO

    DE INVALIDEZ TOTAL Y PERMANENTE

    La Institucin se obliga a mantener en vigor la pliza durante todo el plazo contratado, sin ms pago de primas

    por parte del asegurado

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    BENEFICIOS POR

    CCCC

    CCCCGGGGCTCTCTCTTTTT123

    la pliza contratada.CANCELACION:De no hacerse efectivo el beneficio secancelar, automticamente, cuando elasegurado cumpla los 60 aos de edad

    BENEFICIO DE PAGO ADICIONAL POR INVALIDEZ TOTAL Y PERMANENTEEste beneficio implica que si el aseguradoqueda invalidado total y permanentemente, lacompaa le pagara, a el mismo, la sumaasegurada contratada para este clusula.OPERACION:Si el asegurado llega a sufrir un estado deincapacidad total y permanente, la Institucinse vera obligada a pagar la suma aseguradapor este beneficioSU FINALIDAD:Otorgar una cantidad, para que, al ocurrir lainvalidez, el asegurado pueda continuar unnivel de vida decoroso. Se recomienda,especialmente, para las personas que nogozan de la seguridad social.SUMA ASEGURADA:Deber establecerse dentro de los siguientesparmetros, conforme a las polticas de cadacompaa.En ningn caso ser superior a la sumaasegurada del plan principal o bsico.

    BENEFICIOS POR INVALIDEZ

    INVALIDEZ TOTAL Y PERMANENTE

    BENEFICIO DE PAGO ADICIONAL POR INVALIDEZ TOTAL Y PERMANENTE

    Si el asegurado llega asufrir un estado deincapacidad total ypermanente, laInstitucin se veraobligada a pagar lasuma asegurada poreste beneficio.

    INCAPACIDAD INVALIDEZ TOTAL Y PERMANENTE

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    LIQUIDACION:Una vez transcurrido el perodo de espera, elasegurado podr recibir la suma aseguradacontratada, bajo alguna de las siguientesformas, segn lo indique el clausulado decada compaa.-En una sola exhibicin-Una parte en efectivo y otra parte en rentasmensuales-En forma de rentas mensuales.CONTRATACION:Algunas compaas hacen obligatoria estacobertura, en conjunto con el beneficio deexencin de pago de primas.

    BENEFICIO DE RENTASEste beneficio consiste en que si el

    asegurado se incapacita temporalmente, yasea a causa de accidente o enfermedad, ypor esta causa se ve imposibilitado a percibiringresos, la compaa le pagar la rentacontratada, mientras permanezca laincapacidad, hasta el plazo contratado

    BENEFICIO INCAPACIDAD CON RENTAS

    INCAPACIDAD TEMPORAL POR ACCIDENTE O ENFERMEDAD

    SE VE IMPOSIBILITADO PARA RECIBIR

    INGRESOS

    La compaa le pagarla renta contratada,mientras permanezca laincapacidad, hasta elplazo contratado.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT124

    Beneficio de UltimosGastosCon las sola presentacin de esta pliza y delCertificado Mdico de Defuncin, salvorestriccin legal en contrato y siempre quehubieren transcurrido dos aos desde laexpedicin de la pliza, de su ltimarehabilitacin y/o de la contratacin deaumentos de suma asegurada, la Compaahar un anticipo inmediato del 10% de lasuma asegurada, sin que este pago excedade dos veces el salario mnimo general anualvigente en el Distrito Federal, en la fecha enque ocurra el fallecimiento, ni del importe aque tuviere derecho el beneficiario que losolicite. En caso de que hubiere variosbeneficiarios, el pago correspondiente se hara aqul que presente a la Compaa elCertificado Mdico de Defuncin.La cantidad de que la pliza se encuentre

    gravada con prstamo y el saldo a favor delos beneficiarios sea menor que la cantidadque ampara esta clusula, se concedercomo pago mximo por la misma y comofiniquito de la pliza, el saldo a favor de losbeneficiarios.

    BENEFICIO DE ULTIMOS GASTOS

    LA POLIZA TIENE 2 AOS DE

    EXPEDICION DE LA POLIZA,

    REHABILITACION O AUMENTO DE SUMA

    ASEGURADA:

    ANTICIPO INMEDIATO DEL 10% DE

    LA SUMA ASEGURADA

    SI AL FALLECIMIENTO DEL ASEGURADO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT125

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Siendo este un curso que nos permite identificaruna panormica de coberturas con diferentesopciones a sugerir a nuestros prospectos parahacer frente a riesgos que afectan la capacidadeconmicamente productiva de aqullos,podemos contar con un Seguro contraAccidentes Personales.

    En caso de que nuestro asegurado sufra unaccidente habr que considerar, nonecesariamente el fallecimiento, por lo que hayque atender la pliza de Accidentes Personalescompleta.Definicin de accidenteEs aquel acontecimiento proveniente de unacausa externa, sbita y violenta que producelesiones corporales o la muerte del asegurado.Coberturas de Accidentes PersonalesPara este seguro xisten 4 SECCIONES, quecubren las consecuencias que de un suceso deeste tipo se puedan derivar.

    Muerte Accidental (Cobertura bsica) en logeneral es la nica que puede contratarse demanera independiente.Prdidas Orgnicas (Cobertura opcional)Incapacidad por accidente (Cobertura opcional)

    V.I. ACCIDENTES PERSONALES ACCIDENTEEs aqul acontecimiento proveniente de una causa externa, sbita yviolenta que produce lesiones corporales o la muerte del asegurado.

    COBERTURA BASICA COBERTURAS OPCIONALES

    Ambas manos, ambos pies o la vista de ambos ojos

    100% Ambas manos, ambos pies o la vista de ambos ojos

    100%

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT126

    Gastos Mdicos por accidente (Coberturaopcional)

    SECCION DE MUERTE ACCIDENTAL: (edadesde contratacin es entre los 12 y los 65 aos)La Institucin pagar a los beneficiariosdesignados por el asegurado, la suma aseguradaconvenida, en caso de que el aseguradoperdiese la vida por accidente, tal y como sedefine en la pliza y dentro del plazo establecidode 90 das a partir de la fecha en que ocurri elaccidente.SECCION DE PRDIDAS ORGANICASSi a consecuencia de un accidente amparado lalesin produjera cualesquiera de las prdidasenumeradas en la escala de indemnizacin, laInstitucin pagar al asegurado los procentajesque ah se establecen, calculados sobre la sumaasegurada de la plizaCuando sean varias las prdidas orgnicasocurridas durante la vigencia de la pliza, lacompaa cubrir la indemnizacincorrespondiente a cada una de ellas, sin que elconjunto exceda del monto contratado para estaseccin.La cobertura de Prdidas Orgnicas opera con laaplicacin de dos escalas diferentes deindemnizacin A y B, cada una con surespectiva tarifa, aplicndose una u otra aeleccin del asegurado, o bin de acuerdo con lapoltica que cada compaa establezca.

    vista de ambos ojosUna mano y un pie 100%

    Una mano o un pie y la vista de un ojo

    100%

    Una mano o un pie 50%

    La vista de un ojo 30%

    El pulgar de cualquier mano

    15%

    El ndice de cualquier mano

    10%

    Una mano y un pie 100%

    Una mano o un pie y la vista de un ojo

    100%

    Una mano 50%

    Tres dedos comprendiendo el pulgar o el ndice de una mano

    30%

    Tres dedos que no sean el pulgar o el ndice de una mano

    25%

    El pulgar y otro dedo que no sea el ndice de una mano

    25%

    El ndice y otro dedo que no sea el pulgar de una mano

    20%

    El pulgar de cualquier mano 15%

    El dedo medio, el anular o el meique

    5%

    Un pie 50%

    La vista de un ojo 30%Amputacin parcial de un pie, comprendiendo todos los dedos

    30%

    Sordera completa de los odos 25%

    Acortamiento de un miembro inferior, por los menos 5 cm.

    15%

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    BENEFICIO POR INCAPACIDAD TOTALSi como consecuencia directa de un accidente eindependientemente de cualesquiera otrascausas, el asegurado, dentro de los primeros10 das contados a partir de la fecha delaccidente, sufriera una incapacidad para eldesempeo de todas las labores diarias propiasde su ocupacin y se encontrara recluido porindicacin mdica en un sanatorio u hospital, oen su domicilio, la compaa pagar, mientrassubsistan la incapacidad y la reclusin, laindemnizacin diaria estipulada en la pliza,por un periodo que no exceder de 1460 das.BENEFICIO POR INCAPACIDAD PARCIALSi dentro de los 10 das de la fecha delaccidente o inmediatamente despus de unperodo de incapacidad total, las lesionessufridas por el asegurado le causaren unaincapacidad para desempear una o ms laborespropias de su ocupacin, la compaa pagardurante el perodo de dicha incapacidad, el 40%de la indemnizacin contratada por incapacidadtotal, pero sin exceder el perodo de 182 dasconsecutivos, contados desde la fecha delaccidente.

    COBERTURA DE GASTOS MEDICOS PORACCIDENTESi como consecuencia de un accidenteamparado, el asegurado se viera precisado asometerse a atencin mdica u hospitalaria, lacompaa pagar al asegurado los gastos pordicha atencin (mdico, cirujano, enfermera,hospital, medicamentos, ambulancia, etc.) hastapor la cantidad mxima asegurada por esteconcepto.

    BENEFICIO POR INCAPACIDAD

    1. Si dentro de losprimeros 10 dasdespus del accidentesufre una incapacidadtotal

    2. Y se encontrarrecluido en un hospitalo en su domicilio porprescripcin mdica

    3. Recibir unaindemnizacin diariapor un perodo que noexceder de 1460 das.

    1. Si dentro de los primeros 10das despus del accidente inmediatamente despusde un perodo deincapacidad total le causanuna incapacidad parcial

    2. Recibir una indemnizacindel 40% de que reciba ohubiera recibido porincapacidad total.

    3. Sin exceder el perodo de182 das consecutivos,contados desde la fecha delaccidente.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT127

    por la cantidad mxima asegurada por esteconcepto.NO QUEDAN CUBIERTOSLos gastos realizados por acompaantes delasegurado durante su internamiento en unsanatorio u hospitalLos gastos que resulten de tratamientos dentales(prtesis, ortodoncia) como consecuencia deaccidente, as como los gastos de ambulancia,normalmente estn sujetos a un lmite que en lapliza expresa.RESPONSABILIDAD MAXIMA PARA LACOMPAAPor cada accidente durante la vigencia, noexceder la suma asegurada bajo esta seccin.Los gastos cubiertos se pagarn hasta por unmximo de 365 das, contados a partir de lafecha del accidente.La Suma Asegurada mximaPor muerte Accidental:Se debe de considerar que nunca se rebasenms de 100 meses de sueldo mensual delsolicitante sin considerar ingresos provinientes derentas o inversiones.Para la cobertura de Incapacidad:Ser equivalente al 60% de sus ingresos.

    Cuando existan varias plizas para un mismoasegurado, las sumas aseguradas conjuntas nodebern exceder los mximos establecidos por laCompaa de Seguros.

    SUMA ASEGURADA MAXIMA

    Nunca se rebasen ms de 100meses de sueldo mensual delsolicitante sin consideraringresos provinientes de rentaso inversiones.

    Ser equivalente al 60% desus ingresos.

    El monto del seguro debe estar relacionado con el ingreso del cliente, ya que el seguro tiene el propsito de que la persona

    mantenga su mismo nivel de vida, no que mejore atravs de la indemnizacin. El monto del seguro es la responsabilidad

    mxima de la Institucin (Suma Asegurada) y estarn cubiertos hasta 365 das

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Los elementos ms importantes para determinarel costo del seguro son: OcupacinDeporte.Monto del seguro con relacin a los ingresos delsolicitanteEdadRiesgos subnormalesRelacin peso estatura

    OcupacinEste es uno de los problemas que ms a menudo

    nos encontramos, debido a que en la actualidadexsten muchos empleos que con el paso de losaos han perdido los factores de riesgo, as tambinexiste la creacin de nuevos empleos que an no sehan registrado.En este caso es recomendable que el seleccionador,con ayuda del agente, detalle con claridad laslabores propias del asegurado con referencia a sutrabajo.DeportesAn cuando se supone que cada solicitante practica

    uno o ms deportes como distraccin dentro de suvida normal de trabajo, es muy conveniente que elasegurado detalle con precisin, las actividades quegusta de desarrollar, as como la frecuencia con lasque practica el deporte, sobre todo cuando sondeportes que tienen cierto grado de peligro, comobase ball, foot ball, jockey, carreras , alpinismo,

    SECCIONES MAS IMPORTANTES PARA DETERMINAR EL COSTO DEL SEGURO

    OCUPACION

    DEPORTES Y/O AFICIONES

    MONTO DEL SEGURO CON RELACION A LOS INGRESOS

    SUMA ASEGURADA

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT128

    base ball, foot ball, jockey, carreras , alpinismo,caceras frecuentes, paracaidismo, etc.EdadLas edades mximas de admisin y de renovacin

    sern las que fije la compaa para cada tipo depliza de accidente.Riesgos subnormalesEs un poco difcil hacer una enumeracin de las

    deformidades corporales y enfermedades quepueden influir para considerar como riesgosubnormal. Algunas de esas enfermedades son:diabetes, convulsiones, ceguera, drogas, gota,hipertensin arterial, infarto, etc.Riesgos catstrofe.Se debe entender como el cmulo de personas que

    pueden viajar y se encuentran cubiertas por lamisma pliza, usando el mismo medio de transportesean estos areos, terrestres o martimos.En este caso se pueden tomar en cuenta todos losposibles medios de transporte, ms cuando estapliza sea contratada para viajes.Edades de ContratacinPara la Cobertura de Muerte Accidental, la edad

    mnima de contratacin es de 12 aos.Para la Cobertura de Prdidas Orgnicas la edad

    mnima ser 1 ao.Para Indemnizacin Diaria por Incapacidad Total o

    Parcial, la edad mnima de contratacin es de 16aos, y

    Para la cobertura de Reembolso de GastosMdicos, la edad mnima de contratacin es de 1ao.

    EDAD

    RIESGOS SUBNORMALES

    RIESGO CATASTROFE

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    PLAZO DEL SEGUROLa pliza slo reconocer como amparado elfallecimiento y la prdida de miembroscuando se produzca dentro de un plazo de 90das a partir de la fecha del accidente.Tratndose de las secciones de incapacidady Gastos Mdicos, la incapacidad o delprimero de dichos gastos deber habersepresentado en un plazo mximo de 10 das apartir de la fecha del accidente.

    ExclusionesComo en cualquier pliza el seguro tieneexclusiones:Accidentes en servicio militar, actos de guerra,rebelin o insurreccin.Actos delictivos intencionales en que participedirectamente el aseguradoEnfermedades corporal o mentalSuicidio o cualquier intento del mismo o mutilacinvoluntaria.Hernias o eventraciones.EnvenenamientosAbortosInfeccionesInhalacin de gases o humo

    PLAZO DEL SEGURO

    MUERTE ACCIDENTAL , PERDIDAS ORGANICASCuando las consecuencias del accidente seproduzcan dentro de los 90 das a partir de la fechadel accidenteGASTOS MEDICOS, INCAPACIDADEl primero de los gastos deber habersepresentado en un plazo mximo de 10 das a partirde la fecha del accidente

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    Accidentes en servicio militar, actos de guerra, rebelin o insurreccin.Actos delictivos intencionales en que participe directamente el aseguradoEnfermedades corporal o mentalSuicidio o cualquier intento del mismo o mutilacin voluntaria.Hernias o eventraciones.EnvenenamientosAbortosInfeccionesInhalacin de gases o humoRadiaciones ionizantes.Alcoholismo, txico y enervantes.

    EXCLUSIONES

    CCCC

    CCCCGGGGCTCTCTCTTTTT129

    Inhalacin de gases o humoRadiaciones ionizantes.Alcoholismo, txico y enervantes.Gastos incurridos por acompaantes delasegurado en un hospital o sanatorio

    RIESGOS QUE PUEDEN CUBRIRMEDIANTE CONVENIO EXPRESO(exclusiones relativas)Cuando viaje en taxis areos o en aeronaves queno pertenezcan a una lnea comercial legalmenteestablecida, autorizada para el servicio detransporte regular de pasajerosComo piloto, mecnico de vuelo o miembro de latripulacin de cualquier aeronaveComo ocupante de cualquier vehculo motorizado,en carreras, pruebas o contiendas de velocidad.En motocicletas, motonetas o vehculos similaresde motor.Paracaidismo, buceo o alpinismo, salvo convenioexpreso.AUMENTO DE SUMA ASEGURADAEs posible contratar el seguro de accidentes conesta clusula, cuyo funcionamiento consiste enincrementar en cada renovacin anual, completa yconsecutiva, y sin aumento en primas, las sumasaseguradas para las secciones de MuerteAccidental y Prdidas Orgnicas, en un 10% hastaalcanzar un incremento de 50% de la sumaasegurada original.

    Alcoholismo, txico y enervantes.Gastos incurridos por acompaantes del asegurado en un hospital

    (exclusiones relativas)Cuando viaje en taxis areos o en aeronaves que no pertenezcan a unalnea comercial legalmente establecida, autorizada para el servicio detransporte regular de pasajerosComo piloto, mecnico de vuelo o miembro de la tripulacin de cualquieraeronave

    Como ocupante de cualquier vehculo motorizado, en carreras, pruebas ocontiendas de velocidad.En motocicletas, motonetas o vehculos similares de motor.Paracaidismo, buceo o alpinismo, salvo convenio expreso.

    RIESGOS QUE SE PUEDEN CUBRIR MEDIANTE CONVENIO EXPRESO

    1 2 3 4Renovacin anual

    CompletaConsecutiva

    Sin aumento de prima

    Aumento de Suma Asegurada para Muerte Accidental y Prdidas

    OrgnicasEn un 10% hasta alcanzar un incremento del 50% de la suma asegurada original

    AUMENTO DE SUMA ASEGURADA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Esta pliza ampara los gastos sealados en lapliza que son producidos a consecuencia deun accidente o enfermedad, reembolsando laCompaa, el costo de los mismos hasta por elmonto de la suma asegurada y hasta por losplazos indicados, siempre y cuando dichosgastos hayan sido erogados dentro de laRepblica Mexicana. Aplicando el deducible ycoaseguro sealados en la cartula>>Formas de Contratacin.Esta pliza se puede contratar en formaindividual, familiar o colectiva.PERSONASPERSONAS ASEGURADASASEGURADASLa pliza incluye al titular, cnyuge o concubinae hijos solteros menores de 25 aos, quedependan economicamente de l.Los hijos del matrimonio que nazcan durante lavigencia de la pliza quedarn amparados deacuerdo a las polticas de cada compaa,siempre y cuando se le notifque a la compaaen un plazo de 30 das contados a partir de lafecha de nacimiento.Edades de contratacinLos lmites de edad de aceptacin para estapliza son desde el nacimiento, hasta los 64

    SEGURO FAMILIAR DE GASTOS MEDICOS MAYORES

    FORMAS DE CONTRATACION

    PERSONAS ASEGURADAS

    EDADES DE CONTRATACION

    INDIVIDUALFAMILIAR

    COLECTIVA

    TITULARCONYUGE O CONCUBINAHIJOS SOLTEROS (QUE NO TENGAN INGRESO)EXCEPCIONALMENTE (ASCENDIENTES)

    PARA CONTRATAR:HASTA LOS 64 AOS

    PARA RENOVAR:HASTA LOS 69 AOS

    SEGURO INDIVIDUAL DE GASTOS MEDICOS MAYORES

    ES UNA OPCION PARA EL BIENESTAR YSEGURIDAD DE LOS MEXICANOS, ENRESPUESTA A LA PREOCUPACION POR LASALUD.

    LOS GASTOS MEDICOS QUE SE GENEREN POR LOS SERVICIOS QUE REQUIERA EL

    ASEGURADO O SU FAMILIA, DERIVADOS DE UNA ENFERMEDAD O ACCIDENTE CUBIERTO

    POR LA POLIZA

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    V.2. GASTOS MDICOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT130

    pliza son desde el nacimiento, hasta los 64aos. En caso de renovacin, el Aseguradopodr contar con derecho a renovar hasta laedad de 69 aos. Se considerar como edadde aceptacin o renovacin la que elAsegurado y sus dependientes econmicostengan al momento de la celebracin de lapliza, o la fecha de renovacin en su caso.TERMINOLOGIA BASICA

    Perodo de EsperaEs el lapso de tiempo ininterrumpido que debetranscurrir desde la fecha de alta del aseguradopara que se pueda cubrir un padecimiento, deacuerdo a las especificaciones de la pliza.

    Red y proveedores mdicosMdicos y Hospitales vinculados con laaseguradora por convenios que tienen porobjeto proporcionar a los asegurados el serviciode pago directo de los Gastos MdicosCubiertos , por la atencin brindada por estosprestadores a los asegurados.ANTIGEDADEs la fecha en que el Asegurado es dado dealta en la pliza siempre y cuando sta serenueve con vigencias sucesivasininterrumpidas. Si la pliza se cancela o no serenueva, el Asegurado perder su antigedad.Si el Asegurado decide contratar nuevamenteen el futuro este tipo de pliza, la nueva fechade alta ser considerada como fecha deantigedad.

    Es un tiempo determinado, en el cual no se amparanlos gastos mdicos para los riesgos que despusquedan cubiertos por el contrato.Es el lapso de tiempo ininterrumpido que debetranscurrir desde la fecha de alta del aseguradopara que se pueda cubrir un padecimiento

    Mdicos y Hospitales vinculados con laaseguradora por convenios que tienen por objetoproporcionar a los asegurados el servicio de pagodirecto de los Gastos Mdicos Cubiertos

    Es la fecha en que el Asegurado es dado de altaen la pliza siempre y cuando sta se renueve convigencias sucesivas ininterrumpidas

    ES LA CANTIDAD MAXIMA DE RESPONSA- B ILIDAD DE ASEGURADORA, POR

    ASEGURADO, A CONSECUENCIA DE CADA EVENTO, DE ACUERDO A LOS PLANES

    CONTRATADOS.

    EN CASO DE QUE POR ALGUN EVENTO LLEGASE A AGOTARSE LA SUMA

    ASEGURADA CONTRATADA, ESTA SE REINSTALARA AUTOMATICAMENTE, POR OTRO TANTO IGUAL, SOLO PARA CUBRIR NUEVOS ACCIDENTES O ENFERMEDADES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Perodo de BeneficioEsta pliza abarcar las coberturas

    especificadas en la cartula, aplicando lasexclusiones correspondientes y terminar alpresentarse alguna de las siguientessituaciones:I. Al certificarse la curacin del

    padecimiento de que se trate, a travs del altamdica.II. Al agotarse el lmite mximo de

    responsabilidad convenido por las partes.III. Al concluir el trmino que para

    estos efectos se haya pactado para laprestacin del servicio, el cual no podr serinferior a 730 das, contados a partir de lafecha en la que termina la vigencia delcontrato.

    ResidenciaPara efectos de esta pliza solamenteestarn protegidos por este seguro losAsegurados que vivan permanentemente enla Repblica Mexicana.Accidente.Acontecimiento proveniente de una causaexterna, imprevista, sbita y violenta queproduce lesiones o la muerte en la personadel asegurado.No se consideran accidente las lesiones

    Abarcar las coberturas especificadas en lacartula, aplicando las exclusionescorrespondientes y terminar al presentarsealguna de las siguientes situaciones:

    I. Al certificarse la curacin , a travs del alta mdica.II. Al agotarse el lmite mximo de responsabilidadIII. Al concluir el trmino que para estos efectos se haya

    pactado para la prestacin del servicio.

    Estarn protegidos por este seguro losAsegurados que vivan permanentemente en laRepblica Mexicana.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    Acontecimiento proveniente de una causa externa, imprevista, sbita y violenta que produce lesiones o la muerte en la persona del

    Lapso en el cual la pliza no est pagada.Comienza al inicio de la vigencia de la pliza orecibo y termina cuando se recibe el pagocompleto de la prima o fraccin pactada, si ste serealiz despus de trascurrido el perodo de gracia

    CCCC

    CCCCGGGGCTCTCTCTTTTT131

    No se consideran accidente las lesionescorporales o la muerte provocadasintencionalmente por el asegurado.EnfermedadToda alteracin de la salud del aseguradoque resulte de la accin de agentes morbososde origen interno o externo con relacin alorganismo, que amerite tratamiento mdicoy/o quirrgico.CoaseguroCantidad a cargo del Asegurado comoporcentaje de los gastos cubiertos despusde aplicar el deducible.DeduciblePrimera cantidad a cargo del Asegurado porcada Accidente o Enfermedad Amparada,excepto cuando en un Accidente, quedensimultneamente afectados variosAsegurados de una misma pliza, caso en elque se aplicar una sola vez.Objetivo del deducible:Suprimir la necesidad de tramitar un grannmero de reclamaciones pequeas, ya queencareceran el costo del seguro.Excluir de la cobertura los gastos pequeosque al no desequilibrar en forma importante elpresupuesto familiar pueden incluirse dentrode los gastos normales sin mayor problemapara la familia.Menor costo del seguro a mayor deducible

    Toda alteracin de la salud del asegurado queresulte de la accin de agentes morbosos deorigen interno o externo con relacin alorganismo, que amerite tratamiento mdico y/oquirrgico.Enfermedad que se contrae en el teromaterno o con la que se nace. Alteracin delestado de salud fisiolgico y/o morfolgico enalguna parte, rgano, sistema del cuerpo.

    Cantidad a cargo del Asegurado comoporcentaje de los gastos cubiertos despus deaplicar el deducible.Se aplica despus de haber restado a laspartidas procedentes el deducible convenido yse expresa en porcentajes que fluctan entre el10 y el 20%

    Primera cantidad a cargo del Asegurado porcada Accidente o Enfermedad Amparada.

    EXCEPTO CUANDO:Queden simultneamente afectados variosAsegurados de una misma pliza, caso enel que se aplicar una sola vez.

    lesiones o la muerte en la persona del asegurado.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Perodo al descubierto:Lapso en el cual la pliza no estapagada.Comienza al inicio de la vigencia de lapliza o recibo y termina cuando se recibe elcompleto de la prima o fraccin pactada, si estese realiz despus de transcurrido el perodode gracia.Perodo de gracia: (Art. 40 L.S.C.S)Tiempo que tiene el asegurado para pagarde prima pactada en el contrato.Gasto usual y acostumbradoEs el costo usual acostumbrado en la atencinde servicios mdicos, medicamentos,honorarios quirrgicos, etc.

    Gastos Mdicos CubiertosGastos de Hospitalizacin y Mdicos siempreque sean proporcionados por instituciones opor personas autorizadas legalmente para elejercicio de su actividad, que no sean familiaresdel Asegurado.Honorarios quirrgicosHonorarios por consultas mdicasGastos dentro del hospitalCama extra para el acompaanteEquipo de anestesia

    GASTO USUAL Y ACOSTUMBRADO

    Es el costo usual acostumbrado en la atencin deservicios mdicos, medicamentos, honorariosquirrgicos, etc

    GASTOS MEDICOS CUBIERTOS

    Gastos de Hospitalizacin y Mdicos siempre quesean proporcionados por instituciones o porpersonas autorizadas legalmente para el ejerciciode su actividad, que no sean familiares delAsegurado.

    qu contemplan los honorarios quirrgicos?

    TABLA DE INTERVENCIONES

    QUIRURGICAS

    ES LA RELACION DE INTERVENCIONES QUIRURGICAS EN QUE SE INDICA EL PORCENTAJE, PARA DETERMINAR EL

    IMPORTE MAXIMO CUBIERTO PARA CADA UNA DE ELLAS

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT132

    Equipo de anestesiaHonorarios de anestesistaHonorarios de enfermerasRadioterapia, quimioterapia, hidroterapia,inhaloterapia, fisioterapia.Honorarios de mdicos quiroprcticos.Ciruga reconstructiva por accidenteConsumo de oxigenoTransfusiones de sangre, aplicaciones delplasma, suero y otras sustancias semejantesCompra Renta de aparatos ortopdicos yprtesis.Renta de equipo tipo hospital paraconvalecencia domiciliaria.MedicamentosEstudios de laboratorio y gabineteComplicaciones del embarazo, parto opuerperio.Operacin cesreaPadecimiento congnitos de los aseguradosnacidos durante la vigencia de la plizaAmbulancia terrestre. ( area sujeta arestricciones).Los siguientes padecimientos, cuando suprimera intervencin ocurra a los dos aos decobertura ininterrumpida: Tumoracin mamaria,hemorroides, fstulas rectales o prolapsos delrecto, Amigdalitis y adenoides, Hernias.

    qu contemplan los gastos por hospital o sanatorio?

    PROGRAMACIN DE CIRUGAS

    Autorizacin previa que el asegurado recibe para ser intervenido quirrgicamente,

    incluyendo hospitalizacin, ciruga ambulatoria u/o tratamiento mdico

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Gastos No CubiertosEl contrato de seguro contenido en esta

    pliza no cubre gastos que se originen aconsecuencia de:

    Enfermedades preexistentes, entendindosecomo tales, aquellas que en fechaanterior a la iniciacin de la coberturapara cada Asegurado, fuerondiagnosticadas por un mdico, o fueronaparentes a la vista, o fueron de las que,por sus sntomas o signos, no pudieronpasar desapercibidas.

    Tratamientos psiquitricos, opsicolgicos, trastornos de enajenacinmental, estados de depresin psquica onerviosa, histeria, neurosis o psicosis,cualquiera que fuesen susmanifestaciones clnicas, as comotratamientos para corregir trastornos de laconducta y el aprendizaje.

    Afecciones propias del embarazo, aborto,partos prematuros o partos normales.Legrados cualquiera que sea su causa ytoda complicacin del embarazo, delparto o del puerperio que no seanprecisamente las consignadas en estapliza en el inciso correspondiente a>> Gastos Cubiertos>>.

    Tratamientos y padecimientos que

    GASTOS NO CUBIERTOS

    El contrato de seguro contenido en esta pliza nocubre gastos que se originen a consecuencia de:

    NO CUBRE

    ENFERMEDAD PREEXISTENTEAqulla que en fecha de iniciacin de la cobertura para cada asegurado haya

    sido:

    Diagnosticada por un mdico Aparente a la Vista Del tipo de enfermedades que por sus sntomas

    o manifestaciones no pudieron pasardesapercibidas.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT133

    Tratamientos y padecimientos queresulten del alcoholismo o toxicomanas.

    Tratamientos o intervenciones quirrgicasde carcter esttico o plstico.

    Tratamiento de calvicie, obesidad,reduccin de peso o esterilidad.

    Adquisicin de anteojos, lentes decontacto, lentes intraoculares y aparatosauditivos.

    Tratamientos o intervenciones quirrgicascon el fin de corregir el astigmatismo,presbiopa, hipermetropa, miopa yestrabismo.

    Intervenciones quirrgicas o tratamientospara control de la fertilidad, natalidad ysus complicaciones.

    Gastos realizados por acompaantes delasegurado durante el internamiento deste en sanatorio u hospital exceptocama extra.

    Cualquier cuidado o tratamiento debido alesin autoinfligida, intento de suicidio,an cuando se cometa en estado deenajenacin mental.

    Lesiones que ocurran en ria conprovocacin por parte del asegurado opor actos delictuosos intencionales enque participe directamente el asegurado oestando bajo influencia de bebidasalcohlicas o de algn enervante,estimulante o similar que no haya sidopreescrito por un mdico.

    GASTOSCUBIERTOS

    CUARTO DE HOSPITALHONORARIOS DE MDICOS Y CIRUJANOSHONORARIOS POR CONSULTAS MDICASSUMINISTROS DE HOSPITALENFERMERAANESTESISTASERVICIO DE DIAGNSTICOSERVICIO DE TERAPIAAMBULANCIAMEDICAMENTOSAPARATOS ORTOPDICOS Y PRTESISTRASPLANTE DE RGANOSRENTA DE EQUIPO TIPO HOSPITAL OXGENO, SANGRE, PLASMA, SUERO, ETC.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Lesiones que el asegurado sufra enservicio militar de cualquier clase, enactos de guerra, insurreccin, revolucino rebelin..

    Lesiones que el asegurado sufra enservicio militar de cualquier clase, enactos de guerra, insurreccin, revolucino rebelin.

    Lesiones que el asegurado sufra cuandoviaje como ocupante de algn automvil,motocicleta o cualquier otro vehculosimilar en carreras, pruebas o contiendasde seguridad, resistencia o velocidad.

    Prcticas de box, lucha greco romana,lucha libre, charrera, tauromaquia,deportes areos, alpinismo,paracaidismo, espeleologa y rapel.

    La prctica profesional de cualquierdeporte.

    Lesiones que el asegurado sufra cuandoviaje como piloto, pasajero, mecnico omiembro de la tripulacin de aeronaves,que no pertenezcan a una lnealegalmente establecida y concesionadapara el servicio de transporte regular depasajeros.

    Tratamiento mdico o quirrgico decualquier complicacin de los

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    GASTOS NO CUBIERTOS

    ENFERMEDADES, PADECIMIENTOS, OPERACIONES

    QUIRRGICAS, NO PROVOCADAS POR ACCIDENTE

    INHALACIN DE GASES Y HUMOHOMICIDIOMUTILACIN VOLUNTARIALESIONES EN RIALESIONES EN SERVICIO MILITAR O

    NAVAL ACTOS DELICTUOSOS POR EL

    ASEGURADO GASTOS DERIVADOS POR

    ACOMPAANTESPADECIMIENTOS PREEXISTENTESCURAS DE REPOSOPILOTO O MECNICO EN AERONAVE

    NO COMERCIALCOMO PILOTO TAXI AEREO OCUPANTE AUTOMOVIL O VEHCULO

    DE CARRERAS, VELOCIDAD, RESISTENCIA

    CCCC

    CCCCGGGGCTCTCTCTTTTT134

    cualquier complicacin de lospadecimientos, lesiones, afecciones ointervenciones expresamente excluidasen este contrato.

    Tratamientos dentales, alveolares,gingivales, maxilofaciales y suscomplicaciones, a excepcin deaccidentes.

    Circuncisin. Curas o reposo o descanso, exmenes

    mdicos generales para comprobacindel estado de salud, conocidos con elnombre de cheek up.

    Tratamientos preventivos. Tratamientos en vas de experimentacin. Tratamientos mdico o quirrgico de nariz

    y/o senos paranasales que sea originadopor enfermedad.

    Honorarios y cualquier tipo detratamientos mdicos o quirrgicorealizado por acupunturistas, naturistas yvegetarianos.

    Todos los gastos erogados portratamientos derivados del sndrome deinmunodeficiencia adquirida y suscomplicaciones.

    VELOCIDAD, RESISTENCIA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Pago de siniestros.

    Cuando algn asegurado ha efectuado gastosmdicos cubiertos por la pliza o bien los va aefectuar, tiene oportunidad de elegir entre dostipos de indemnizacin.

    PARTICIPACION DEL ASEGURADO ENTODA PERDIDA O RECLAMACION

    - Reembolso de gastos.- Este es el mtodotradicional de indemnizacin. El aseguradopaga a mdicos, hospitales, farmacias, etc.,recabando de ellos los comprobantes oficiales;solicita a los mdicos tratantes que llenen losformularios respectivos y a su vez llena y firmalos formatos de reclamacin que le proporcionala compaa, la cual una vez analizadosreembolsa va cheque a nombre del propioasegurado.- Pago directo a hospitales.- Las institucionesbajo convenio, pagan directamente al hospital,evitando con ello los fuertes desembolsos quela atencin mdica provoca al asegurado.

    GASTOS MEDICOS MAYORES

    PAGO DE SINIESTRO

    GASTOS MEDICOSAquellos que son preescritos por un mdico ocirujano, autorizado legalmente para elejercicio de su profesin y que sonrazonablemente necesarios para eltratamiento del asegurado, siempre que nosean contratados en exceso de los cargosregulares acostumbrados y convenidos en ellugar en donde se reciben dichos servicios.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT135

    la atencin mdica provoca al asegurado.-La participacin del asegurado en toda prdidao reclamacn de los gastos amparados por lapliza ,se expresa como un porcentaje quenormalmente flucta entre el 10 y el 20%.PAGO DE INDEMNIZACIONESLa cuanta del reembolso para el seguro deGastos Mdicos, se determinar de la siguientemanera:

    Se sumarn todos los gastos mdicoscubiertos, ajustndolos a los lmitesestablecidos en la cartula de la pliza y/oCondiciones Generales y/o endososespecficos. A la cantidad resultante se descontar,primero el deducible y despus la cantidad porconcepto de coaseguro de acuerdo alporcentaje establecido en la cartula de lapliza. El deducible se aplicar para cadaenfermedad o accidente cubierto. Para el reembolso se requerirn lossiguientes documentos:Carta de ReclamacinInforme MdicoComprobantes originales, ySolicitud de reeembolso

    El asegurado paga a mdicos,hospitales, farmacias, etc.,recabando de ellos loscomprobantes oficiales; solicita alos mdicos tratantes que llenen losformularios respectivos y a su vezllena y firma los formatos dereclamacin que le proporciona lacompaa, la cual una vezanalizados reembolsa va cheque anombre del propio asegurado.

    Las instituciones bajo convenio,pagan directamente al hospital,evitando con ello los fuertesdesembolsos que la atencinmdica provoca al asegurado.

    VENTAJAEl asegurado no tendr que efectuar eldesembolso ante la Institucin, puesesta cobrar directamente a laaseguradora.No se le cargar deducible niparticipacin de la prdida, con lacondicin que permanezcahospitalizado un mnimo de 24 horas.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CLAUSULAS ESPECIALESAlgunas compaas ofrecen a susasegurados las siguientes coberturasopcionales.

    Clusula de emergencia en elextranjero: Se pagarn los gastos deatencin mdica cuando el aseguradoestuviera fuera del pas y llegara a necesitaratencin de emergencia, debido a unaccidente o enfermedad aguda (apendicitis,intoxicacin, etc.)Cobertura en el extranjero: Sepagarn los gastos realizados en elextranjero, por la atencin mdica de unaccidente o una enfermedad amparados.

    Normalmente, se incrementan las cantidadesa cargo del asegurado (deducible yparticipacin de la prdida adems de que lastarifas por esta clusula son bastante mselevadas que para la cobertura en territorionacional.

    GASTOS MEDICOS MAYORES

    CLASULAS ESPECIALES

    Clusula de emergencia en el extranjero: Cobertura en el extranjero

    TRAMITES DE RECLAMACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT136

    TRAMITE DE RECLAMACIONPara tramitar cualquier reclamacin cuandono se acuda a establecimientos con conveniode sistema de pago directo, deberobservarse los siguientes puntos:1.Requisitar debidamente los formatoscorrespondientes (el que corresponde a ladeclaracin del reclamante y a la declaracindel mdico tratante)2.Debern acreditarse todos los gastosreclamados, mediante la presentacin de loscomprobantes originales que debern cumplircon los requisitos fiscales en vigor.3.Debern adjuntarse los recibos a las notasde farmacia y tachar en stas las partidas queno correspondan al padecimiento reclamado.4.La compaa slo pagar los honorarios demdicos y enfermeras titulados y legalmenteautorizados para el ejercicio de su profesin ylos gastos de intervencin efectuados ensanatorios y hospitales5.No se reconocer ningn donativo ainstituciones de caridad, beneficencia oasistencia social en donde no se exigeremuneracin.

    Para tramitar cualquier reclamacin cuando no se acuda aestablecimientos con convenio de sistema de pago directo,deber observarse los siguientes puntos:

    1. Requisitar debidamente los formatos correspondientes (elque corresponde a la declaracin del reclamante y a ladeclaracin del mdico tratante)

    2. Debern acreditarse todos los gastos reclamados,mediante la presentacin de los comprobantes originales quedebern cumplir con los requisitos fiscales en vigor.

    3. Debern adjuntarse los recibos o las notas de farmacia ytachar en stas las partidas que no correspondan alpadecimiento reclamado.

    4. La compaa slo pagar los honorarios de mdicos yenfermeras titulados y legalmente autorizados para elejercicio de su profesin y los gastos de intervencinefectuados en sanatorios y hospitales

    5. No se reconocer ningn donativo a instituciones decaridad, beneficencia o asistencia social en donde no seexige remuneracin.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Es el seguro contra las prdidas financierasque se derivan de enfermedades o lesionesfsicas causadas por accidentes. El seguro desalud proporciona el pago de beneficios porenfermedades o lesiones cubiertas por lapliza.El riesgo que ampara el seguro de salud esde dos naturalezas:Un evento futuro e incierto en su realizacin(una enfermedad, una epidemia).Eventos ciertos en su realizacin(vacunacin, campaas de mejoramiento dela salud, etc.)

    Los elementos principales que determinan elcosto de este seguro son:EDAD (exposicin al riesgo, costo del seguro,lmite de aceptacin)SEXO (La mujer es ms propensa a ciertasenfermedades, el costo para la mujer esmayor que para el hombre)Historia clnica familiarCuestionario Mdico y/o pruebas mdicas

    EL SEGURO DE SALUD Surge como respuesta a la necesidad creciente de nuestra sociedad proporcionando los servicios de salud.

    RIESGOS QUE AMPARA EL SEGURO DE SALUD

    EVENTOS FUTUROS E INCIERTOS

    EVENTOS CIERTOS

    ELEMENTOS PARA DETERMINAR EL COSTO:

    SEGURO DE GASTOS

    MEDICOS VS. SEGURO DE

    SALUD

    SEGURO DE GASTOS MEDICOS MAYORES

    Su finalidad es proteger al asegurado contra unaeventualidad econmicamente desfavorable aconsecuencia de un accidente o enfermedad queafecte y ponga en riesgo la salud del mismo.

    SEGURO DE SALUD

    Esta enfocado principalmente a la prevencin,conservacin, restauracin y rehabilitacin de lasalud, entendiendose por salud el completoestado de bienestar fsico, mental y social y nosolo de la ausencia de enfermedad.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    V.3. SEGURO DE SALUD

    CCCC

    CCCCGGGGCTCTCTCTTTTT137

    Cuestionario Mdico y/o pruebas mdicas

    LA SELECCIN DE RIESGOS EN ELSEGURO DE SALUD:

    Se basa principalmente en la Tabla deMorbilidad.Qu indica la Tabla de Morbilidad?

    Indica la probabilidad de que una persona deuna edad determinada sufra una enfermedado invalidez.

    Fuente de informacin para la Seleccinde Riesgos y para la Suscripcin:Se utilizan las mismas herramientas para laseleccin de riesgos vida:Solicitud del seguro.Declaracin del Agente.Exmenes mdicos (si se solicitan)Informe del mdico tratante.

    EDAD (Lmites de aceptacin par la contratacin desde recien nacido hasta 60-65 aos, en Renovacin no hay lmites) SEXO Historia clnica familiar Cuetionario Mdico y/o pruebas mdicas

    SELECCIN DE RIESGOS Y SUSCRIPCION

    Indica la probabilidad de queuna persona de una edaddeterminada sufra unaenfermedad o invalidez

    Solicitud del seguroDeclaracin del agenteExmenes Mdicos (si sesolicitan)Informe del mdico tratante

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Por ello, el programa Nacional de Saluddestaca la importancia del respeto a losderechos de los pacientes, fomentandouna cultura de servicios orientada asatisfacer sus demandas, lo que entraarespetar su dignidad y autonoma,garantizar la confidencialidad de lainformacin generada en la relacinmdico-paciente y brindar una atencinque minimice los mltiples puntos deespera. Aspectos de mayor relevancia enlos que la CONAMED en sus 5 aos delabores ha contribuido intensamente,favoreciendo la aplicacin de mediosalternativos para la solucin deconflictos, y no slo ha puesto adisposicin de mdicos y pacientes laposibilidad de resolver sus diferencias atravs de la conciliacin y el arbitraje,sino que adems, estadsticamente llevaa cabo acciones de gestin, queresuelven problemas inmediatos delpaciente. De igual manera, emite

    CONAMED

    CONAMEDORGANISMO AL CUAL PUEDEACUDIR EL USUARIO DE LOSSERVICIOS DE LAS ISES,PARA CONSULTAS ORECLAMACIONES RESPECTODE LOS SERVICIOS QUE HAADQUIRIDO

    Favoreciendo la aplicacin de medios alternativos para la solucin de conflictos,

    Ha puesto a disposicin de mdicos y pacientes la posibilidad de resolver sus diferencias a travs de la conciliacin y el arbitraje, sino que adems,

    Estadsticamente lleva a cabo acciones de gestin, que le resuelven al paciente problemas .

    Emite recomendaciones para contribuir a elevar la calidad de los serivicios mdicos

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    V.3. SEGURO DE SALUD

    CCCC

    CCCCGGGGCTCTCTCTTTTT138

    paciente. De igual manera, emiterecomendaciones para contribuir a elevarla calidad de los servicios mdicos ymejorar la relacin mdico-paciente. El documento ms importante que maneja la CONAMED es la

    Declaracin de los Derechos de los Pacientes:El asegurado- paciente tiene derecho, cuando hace uso del

    servicio a:

    Recibir un trato digno, Estar informado ( y dar su consentimiento) del

    diagnstico y tratamiento que se le va a dar Tener acceso a los servicios que ha contratado Si no est de acuerdo con el diagnstico del mdico de

    la red, puede recurrir a otro especialista, pagando l la diferencia entre los honorarios del mdico que eligi y los tabuladores que maneja las ISES.

    En caso de error de diagnstico, puede consultar otra opinin dentro o fuera de la red mdica.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    Cmo se llama a las Aseguradoras que se especializan en este tipo de Seguros?

    ISESInstituciones de Seguros Especializadas en Salud, deben:

    Proporcionar un servicio gil, adecuado, atento e idneo de acuerdo a los planes de comercializacin.

    Mantener actualizados los directorios de prestadores de servicios y comunicar la actualizacin a los usuarios

    Mantener de acuerdo a la NOM de salud, y a la Secretara de Salud, las instalaciones propias y los mdicos, o exigir a los

    AUTORIDADES QUE INTEVIENEN EN LA REGULACIN Y SUPERVISIN

    rgano regulador

    SHCP CNSF

    rgano Supervisorrgano dictaminador tcnico especializado respecto de la calidad y suficiencia de los servicios mdicos.

    SSA

    V.3. SEGURO DE SALUD

    CCCC

    CCCCGGGGCTCTCTCTTTTT139

    Salud, las instalaciones propias y los mdicos, o exigir a los prestadores de servicios que cumplan la norma.

    Pueden manejar este ramo.a. Con recursos propiosb. A travs de proveedoresc. O en una combinacin de ambos.

    NIVELES DE ATENCIN DE LA

    SALUD

    PRIMERO Est enfocado a preservar y conservar la salud de la poblacin pormedio de acciones de promocin, proteccin especfica. Etc.

    SEGUNDO Est enfocado al diagnstico y atencin de enfermedades no gravesque no necesitan reposo.

    TERCEROEs la restauracin de la salud con atencin a daos frecuentes y demediana complejidad derivados de las etapas anteriores y laatencin a pacientes que se presentan con urgencias mdicas oquirrgicas.

    CUARTOEs la restauracin y rehabilitacin de la salud a usuarios quepresentan padecimientos de alta complejidad de diagnstico ytratamiento que han sido referidos por los otros niveles de atencin

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SERVICIOS BASICOS (COBERTURA) O DEPRIMER CONTACTO

    La Secretara de Salud propone un planbsico de Salud que estudiaremos,aclarando que cada aseguradora puedeofrecer ms menos servicios segnconvenga.

    Consultas de Mdico de Primer Contacto.Consultas de Mdico Especialista.Estudios simples de Laboratorio y

    Gabinete.Medicina PreventivaLa cobertura de Medicina Preventiva

    comprende consultas y estudiospreventivos segn la edad y el sexo delasegurado, este servicio lo otorgarn losmdicos de la Red Mdica, los beneficiosson:

    Consultas de Control para menores de 12aos.

    Examen Mdico General para mayores de12 aos y menores de 25 aos (examenfsico y de orina).

    Examen Mdico General para mayores de25 aos (historial clnico, examen de orina,examen de glucosa, examen de colesterol,biometra heptica, etc.).

    Consultas Mdicas para el control delembarazo.

    OBJETIVOS

    Medicina Preventiva Deteccin temprana de enfermedades; Medidas para eliminar o disminuir la presencia de enfermedades.

    Restauracin de salud Accin teraputica y de rehabilitacin para recuperar la salud del individuo.

    SEGURO DE SALUD

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT140

    embarazo.BeneficiosSin Costo anlisis de Sida, Colesterol o

    GlucosaAtencin Mdica Telefnica sin costo las 24

    hrs. del da y los 365 das del ao.Consulta de EspecialidadDescuento en Laboratorios Mdicos

    estudios de gabinete y otros.Consulta de Cardiologa incluido

    Electrocardiograma.Consulta de Ginecologa, Papanicolau y

    UltrasonidoConsulta a domicilio las 24 hrs. del da y los

    365 das del ao.Descuento en OdontologaDescuento en todo tipo de ambulancias.Precios especiales en Check Up de Grupo.Descuento en Intervenciones quirrgicasSin restricciones de edad y preexistenciasPrecio reducido para dependientes de los

    empleados.Cobertura sin costo en Toluca y

    Cuernavaca.

    PEDIATRIAAtencin a nios desde su nacimiento hastalos 12 aos. Los adolescentes, hasta los 16aos, pueden entrar en esta especialidad.

    Atencin a adolescentes y adultos, de manerageneral e integral.

    Atencin de mujeres mayores de 14 aos encuanto a sus funciones reproductoras ydesarrollo y funcionamiento hormonal.

    Intervenciones quirrgicas no especializadas(amigdalitis, apendicitis, etc.)

    Medicina interna o medicina general

    GINECO-OBSTETRICIA

    CIRUGIA GENERAL

    Estas especialidades son de primer contacto, su objetivo es detectar oportunamente:

    Cualquier alteracin en la salud, Solucionar cualquier malestar y en su caso Direccionar al asegurado a un especialista para su

    tratamiento.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Gastos Mdicos MenoresLa cobertura de Gastos Mdicos Menores,

    ofrece a los asegurados los siguientesbeneficios:

    Consultas de Mdico de Primer Contacto.Consultas de Mdico Especialista.Estudios simples de Laboratorio y

    Gabinete.

    OTROS SERVICIOS QUE SE OFRECEN

    CATALOGADOS COMO DE SEGUNDO NIVEL

    Consultas con especialistas de segundo nivel (cardio-vascular, neurlogo, onclogo, ortopedista etc.)

    Apoyos de diagnstico especializado (resonancia magnetica, radioterapia etc.)

    Fisioterapia (En caso de lesiones que puedan causar invalidez y/o incapacidad parcial y/o de recuperacin tarda)

    Suministro de aparatos de prtesis y ortopedia. Ortesis (muletas, bastones, andaderas, camas, collarines, etc.) Ciruga especializada (cardio-vascular, angiolgica, oncolgica,

    neurolgica etc.) Servicio Dental preventivo y curativo Hospitalizacin Servicio de ambulancia de traslado Cuidados en casa Suministro de oxgeno Medicamentos.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONASSEGUROS DE PERSONAS

    CCCC

    CCCCGGGGCTCTCTCTTTTT141

    Urgencias Mdicas

    COPAGOParticipacin econmica a cargo del

    Asegurado al utilizar los servicios, lacual puede estar dada como unporcentaje del costo del servicio o comouna cantidad fija. Estos se encuentranindicados en la cartula de la pliza.

    Un porcentaje del costo del servicio o Como una cantidad fija.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT142

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    VI. 1 CONCEPTOS BSICOS

    AUTOMVILESAutorizacin otorgada a una persona menor de edadpara conducir un vehculo particular, emitida porautoridad competente.

    Autorizacin emitida por Autoridad Competente paraconducir vehculos de acuerdo a la clasificacin delicencias.

    A. Autoriza a manejar vehculos de transporteparticular o mercantil de pasajeros que no excedade diez asientos o de carga que no exceda de 3 toneladas.

    B. Vehculos dedicados a la prestacin de serviciopblico de transporte de pasajeros o de carga.

    C. Unidades que tienen ms de 2 ejes, tractores desemi-remolque, camiones con remolque, equiposespeciales mviles, vehculos con gra y engeneral los de tipo pesado.

    D. Motocicletas, motonetas y otros vehculossimilares.

    Es prdida de la razn por el abuso del alcohol

    Estar constituida por el valor comercial del vehculoo de sus partes en la fecha del siniestro.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT143

    o de sus partes en la fecha del siniestro.

    Si el asegurado da aviso del siniestro y el vehculoest libre de detencin, incautacin, confiscacinu otra situacin semejante producida por orden delas autoridades, la compaa se obliga a valuarlos daos.

    Si la compaa no realiza la valuacin de losdaos dentro de las 72 horas siguientes a partirdel aviso del siniestro, el asegurado quedafacultado para proceder a la reparacin de losmismos, salvo que por causa imputable alasegurado no se pueda llevar a cabo la valuacin.

    Excepcin que el vehculo sea reparado antes dela valuacin (72 horas).

    La indemnizacin en prdidas parciales serealizarn de acuerdo al valor factura derefacciones y mano de obra ms los impuestosque en su caso se generen.

    Terminada la valuacin y reconocida suresponsabilidad la Institucin pagar en efectivo(Cheque) el importe de los daos.

    Cuando la reparacin del vehculo exceda el 50%del valor comercial, a solicitud del aseguradodeber considerarse que hubo prdida total, salvoconvenio contrario si el mencionado costo excededel 75% de ese valor, siempre se considerar queha habido prdida total.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMVILES

    SEGURO OBLIGATORIO

    SUVA

    Objetivo Que toda persona lesionada o fallecida poraccidente de trnsito en el D.F, obtenga unaindemnizacin, ya sea el propio lesionado o losfamiliares del fallecido.

    Riesgos Cubiertos(ALCANCE)

    (LIMITACIONES)

    Ampara la responsabilidad civil del aseguradopor daos a terceros en sus personas.Cubre los gastos mdicos, honorariosquirrgicos, ambulancia y todo aquel propio ynecesario para el restablecimiento delaccidentado, incluyendo indemnizacin porinvalidez parcial o total y la muerte.

    Nota: Es importante sealar que los daoscausados a los bienes de terceras personas,estn expresamente excluidos de estacobertura.

    Suma Asegurada La suma asegurada mnima obligatoria es de

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT144

    Suma Asegurada La suma asegurada mnima obligatoria es de$250,000 pesos por evento, con reinstalacinautomtica.

    Vigencia Anual o Semestral

    Principales condiciones del contrato

    El beneficiario del seguro es el tercerodaado

    Las obligaciones del asegurado son lasmismas del seguro voluntario

    Opera en primera instancia a otros seguroscontratados, es decir, el seguro voluntario esen exceso del obligatorio.

    Cuando el automvil sea vendido, el segurotambin se transfiere.

    Riesgos y bienes excluidos

    Lesiones ocasionadas a causa decompetencia o pruebas de velocidad oresistencia.

    Cuando exista relacin civil o laboral entre elasegurado y el tercero afectado

    Daos ocasionados a terceros en sus bienes. Lesiones a ocupantes del vehculo asegurado. Dao Moral.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    El seguro de automviles, cumple una funcinsocial muy importante al proteger elpatrimonio del propietario del vehculo y leotorga solvencia para reparar los daos quesufra o que cause, proporcionando laseguridad que un individuo o una familiarequiere por la exposicin o riesgo tantodirecto como indirecto derivados del uso desu automvil y que pueden llegar a afectarde manera importante su nivel de vida.

    Clasificacin de los automviles por suuso

    Existen varios tipos de plizas las cuales sepresentan a continuacin:

    Automviles residentes. Vehculos automviles fabricados en Mxico. Vehculos fabricados en el extranjero

    comercializados por agencias nacionales. Vehculos con placas fronterizas, fabricados en el

    pas). Vehculos fabricados en el extranjero, placas

    nacionales. Vehculos clsicos o de coleccin Vehculos residentes con antigedad mayor a 10

    15 aosAutomviles turistas Vehculos que tengan placas de circulacin

    AUTOMVILES

    RAMO DE AUTOMVILES

    1. Automviles Residentes y Particulares

    2. Automviles Turistas3. Agencias automotrices4. Riesgos especiales5. Vehculos de Servicio Pblico6. Carga7. Autobuses 8. Motocicletas

    Por su Riesgo de Uso Bienes Asegurables

    Automviles Vehculos de

    Carga Tractocamio

    nes

    Autobuses Remolques Plataformas Motocicletas

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT145

    Vehculos que tengan placas de circulacin pertenecientes a otros pases.

    Vehculos con placas fronterizas cuyo modelo no se fabrique en el pas.

    Agencias Automotrices Traslado y plan de pisoAutomviles comerciales o de carga. Vehculos destinados al transporte de mercancas

    de cualquier tipo, de uso particular o pblico. (panel, pick-ups y camiones.

    Vehculos de Servicio Pblico.Vehculos con la concesin de traslado depasajeros, con Placas de Servicio Pblico Federal,Estatal o Municipal (taxis o autobuses).

    AUTOBUSES Vehculos con capacidad superior a 11 pasajerosMOTOCICLETAS TIPOS DE COBERTURAS:Coberturas Bsicas:Daos materiales.Robo total.Responsabilidad civilGastos mdicos a ocupantesCoberturas AccesoriasEquipo especial.1.Defensa legal vehicular.2.Ext. De Responsabilidad Civil3.Adaptaciones y/o conversiones.4.SUVA

    La pliza de automviles esta estructurada en secciones por cada una de las siguientes coberturas.

    Las secciones pueden agruparse en los paquetes que normalmente se conocen como: cobertura amplia, cobertura limitada. Paquete de

    responsabilidad civil.

    SECCION DE DAOS MATERIALES

    SECCION DE ROBO TOTAL SECCION DE RESPONSAB.

    CIVIL SECCION DE GASTOS

    MDICOS OCUPANTES

    EQUIPO ESPECIAL ADAPTACIONES Y

    CONVERSIONES EXTENSIN DE

    RESPONSABILIDAD CIVIL ASESORA LEGAL COBERTURA OBLIGATORIA

    (SUVA)

    SECCIONES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    1. Daos Materiales:Esta cobertura se extiende a cubrir los daos

    materiales que sufra el vehculo a consecuencia de:Colisin y vuelcos.Rotura de cristalesIncendio, rayo y explosin.Cicln, granizo, terremoto, erupcin volcnica,derrumbe, alborotos populares, o personas malintencionadas, durante la realizacin de tales actos obien ocasionados por las medidas de represin porautoridades reconocidas.Daos que sufra el vehculo cuando sea transportadoen cualquier medio, as como la contribucin por averagruesa.Actos de personas que tomen parte en paros, huelgas,disturbios de carcter obrero, mtines, alborotospopulares, motines, o de personas mal intencionadasdurante la realizacin de tales actos, o bienocasionados por las medidas de represin tomadas porlas autoridades legalmente reconocidas con motivo desus funciones que intervengan en dichos actos.Accidente del vehculo a bordo del cual la unidadasegurada estuviese siendo transportada.

    COBERTURA BASICA

    RIESGOS CUBIERTOS

    DEDUCIBLE SUMA ASEGURADA

    COLISIONES VUELCOS INCENDIO HUELGAS Y

    ALBOROTOS FENOMENOS

    METEOROLOGICOS

    5 U 10% del valor comercial

    Estar constituidapor el valorcomercial delvehculo o de suspartes en la fechadel siniestro.

    Unidad Asegurada

    Comprende el vehculo automotriz descrito en la cartulade la pliza, con todas las partes y accesorios instaladosoriginalmente por el fabricante

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    V1.2. ESTRUCTURA DE LA PLIZA

    CCCC

    CCCCGGGGCTCTCTCTTTTT146

    asegurada estuviese siendo transportada.Queda entendido que los daos o prdidas materialesque sufra el vehculo, a consecuencia de los riesgosarriba mencionados, quedarn amparados aun en laproteccin que ofrece la pliza:caso de que se produzca cuando el vehculo haya sidoobjeto de hechos que constituyan el delito de abuso deconfianza.

    2- Robo Total.Ampara el robo total del vehculo, y las prdidas o

    daos materiales que sufra a consecuencia de su robo.Se entender por robo total, el apoderamiento del

    vehculo asegurado en contra de la voluntad delAsegurado o conductor de ste, como resultado deldelito de asalto, o cuando el vehculo desaparezca dellugar donde se dej estacionado.Cuando no se contrate la cobertura de daosmateriales, quedan amparados los daos ocasionadospor los riesgos de Incendio, Rayo y Explosin, CiclnHuracn y Granizo, Transportacin, Traslado.La proteccin de esta cobertura operar an cuando loshechos que den lugar al siniestro constituyan el delitode abuso de confianza, excepto cuando dicho delito seacometido por familiares del asegurado.DEDUCIBLESe aplica un porcentaje sobre el valor comercial delvehculo en la fecha del siniestro.En caso de que haya recuperacin despus deperpetuado el robo, solamente se aplicar el deduciblecontratado cuando la aseguradora, realice algn pagopor prdida o dao sufridos al vehculo asegurado.

    CAIDA DE ARBOLES INUNDACION ROTURA DE CRISTALES

    20% Del valor del cristal

    COBERTURA BASICA

    COBERTURA DEDUCIBLE SUMA ASEGURADA

    PERDIDA DEL VEHICULO

    PERDIDA O DAOS MATERIALES

    10-20 % del valor comercial

    Estar constituidapor el valorcomercial delvehculo o de suspartes en la fechadel siniestro.5-10 % del

    valor comercial

    Exensin de Deducible por Prdida Total

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES3. Responsabilidad Civil por Daos aTerceros en sus Personas.Esta cobertura ampara la Responsabilidad Civil en que incurra elasegurado o cualquier persona que con su consentimientoexpreso o tcito use el vehculo asegurado, y que a consecuenciade dicho uso cause lesiones corporales o la muerte a tercerosdistintos de los ocupantes del vehculo asegurado.En el caso de tractocamiones, solamente quedar amparada laResponsabilidad Civil del primer remolque, siempre y cuando seaarrastrado por aquellos; salvo pacto en contrario, no quedaramparado el segundo remolque.El lmite mximo de responsabilidad de la Compaa por estacobertura ser de 3,000,000 (Tres millones de pesos oo/100moneda nacional)En adicin y hasta por una cantidad igual al 50% de su limitemximo de responsabilidad, esta cobertura se extiende a cubrirlos gastos y costas a que fuere condenado el Asegurado o decualquier persona que con su consentimiento expreso o tcito useel vehculo, en caso de juicio civil seguido en su contra con motivode la Responsabilidad Civil amparada por esta cobertura.Esta cobertura cubrir dentro de sus lmites y de acuerdo a suscondiciones, la indemnizacin por dao moral que en su casolegalmente corresponda.

    4. Responsabilidad Civil por daos aterceros en sus bienes.

    R.C. POR DAOS A TERCEROS EN SUS PERSONAS

    AMPARA LA R.C. EN QUE INCURRA EL ASEGURADO O CUALQUIER PERSONA QUE CON SU

    CONSENTIMIENTO EXPRESO O TACITO USE EL VEHICULO AUTORIZADO

    Y COMO CONSECUENCIA DE SU USO CAUSE LESIONES CORPORALES O LA MUERTE A TERCEROS (DISTINTOS A LOS OCUPANTES DEL VEHICULO)

    EL DAO MORAL A TERCEROS, EN BASE A SUS LIMITES

    LOS GASTOS JURIDICOS POR UN JUICIO

    POR MUERTE:

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT147

    terceros en sus bienes.Esta cobertura ampara la Responsabilidad Civil en que incurra elAsegurado o cualquier persona que con su consentimientoexpreso o tcito use el vehculo, y que a consecuencia de dichouso cause daos materiales a terceros en sus bienes.En caso de tractocamiones, solamente quedar amparada laResponsabilidad Civil del primer remolque, siempre y cuando seaarrastrado por aquellos; salvo pacto en contrario, no quedaramparado el segundo remolqueEl lmite mximo de responsabilidad de la Compaa por esta

    cobertura ser de 250,000.00 (Doscientos cincuenta mil pesosoo/100 moneda nacional)En adicin y hasta por una cantidad igual al 50% de su limitemximo de responsabilidad, esta cobertura se extiende a cubrirlos gastos y costas a que fuere condenado el Asegurado o decualquier persona que con su consentimiento expreso o tcito useel vehculo, en caso de juicio civil seguido en su contra con motivode la Responsabilidad Civil amparada por esta cobertura.Cuando no se haya contratado la cobertura de Responsabilidad

    Civil por daos a Terceros en sus Personas esta coberturacubrir, dentro de los lmites y de acuerdo a sus condiciones, laindemnizacin por dao moral que en su caso legalmentecorresponda.

    5. Extensin de Responsabilidad Civil.Daos que ocasione el asegurado cuando maneje una unidaddiferente a la asegurada, pero de las mismas caractersticas yque no cuente con seguro

    POR MUERTE: 5000 DIAS SOBRE LA BASE DEL CUADRUPLE DEL SALARIO MINIMO POR INDEMNIZACION

    GASTOS FUNERARIOS:60 DIAS SOBRE LA BASE DEL CUADRUPLE DEL SALARIO MINIMO

    INCAPACIDAD TOTAL Y PERMANENTE:1095 DIAS SOBRE LA BASE CITADA.

    DAO MORAL: (afecta directamente los sentimientos, reputacin o condicin psicolgica de una persona)LA INDEMNIZACION QUE DETERMINE EL JUEZ

    Se cubre al titular de la pliza contra los daos que cause a

    terceros en sus bienes o personas cuando maneje una unidad que no

    sea la asegurada, que no este asegurado.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    6. Gastos Mdicos Ocupantes.Cubre el pago de gastos mdicos por concepto de hospitalizacin,medicinas, atencin mdica, enfermeros, servicio de ambulancia y gastosde entierro, originados por lesiones corporales que sufra el Asegurado ocualquier persona ocupante del vehculo, ocurridos mientras seencuentren dentro del comportamiento, caseta o cabina destinados altransporte de personas.

    Los conceptos cubiertos bajo esta cobertura son:A.Hospitalizacin: alimentos y cuarto de hospital, fisioterapia, gastos

    inherentes a la hospitalizacin y en general drogas y medicinas que seanprescritas por un mdico.

    B.Atencin mdica: Los servios de mdicos, cirujanos, ostepatas ofisoterapeutas legalmente autorizados para ejercer sus respectivasprofesiones.

    C.Enfermeros: el costo de los servicios de enfermeros o enfermerastitulados o que tengan licencia para ejercer.

    D.Servicios de ambulancia: Los gastos erogados por servicios deambulancia, cuando sea indispensable.

    E.Gastos de entierro: Los gastos se cubrirn hasta por una cantidad igual al50% del lmite de responsabilidad por persona bajo esta seccin, o bienel equivalente a 60 das de salario mnimo general vigente en el DistritoFederal al momento del siniestro, la cantidad que resulte menor, y sernreembolsados mediante la presentacin de los comprobantesrespectivos, mismos que debern cumplir con todos los requisitosfiscales.

    F. En caso de que al momento de ocurrir el accidente el nmero deocupantes exceda de el mximo de personas autorizadas conforme a lacapacidad del vehculo, el lmite de responsabilidad por persona sereducir en forma proporcional.

    G.El lmite mximo de responsabilidad se establecer en la cartula de lapliza.

    GASTOS MEDICOS AOCUPANTES

    Gastos de atencin mdica de las personasque al momento del accidente se encuentrendentro del vehculo asegurado.Se estipula un mximo por cada persona y unlmite por todos los ocupantes.No aplica Deducible

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Bienes Asegurados:Modificacin y/o adicin en carrocera, estructura,recubrimientos, mecanismos y/o aparatos requeridospor el vehculo para el funcionamiento para el cual fuediseado.

    Riesgos Cubiertos:Dao a las adaptacin o modificacin a consecuencia de robo total o daos materiales

    CCCC

    CCCCGGGGCTCTCTCTTTTT148

    pliza.

    7. Adaptaciones y ConversionesSe considerar adaptaciones o conversion, toda modificacin y/o

    adicin en carrocera, estructura, recubrimientos, mecanismosy/o aparatos requeridos por el vehculo para el funcionamientopara el cual fue diseado.

    RIESGOS CUBIERTOSa. Los daos matariales que sufran las adaptaciones y conversiones

    instaladas en el vehculo como consecuencia de los riesgos descritos enla cobertura de daos materiales.

    b. El robo, dao o prdida delas adaptaqciones y conversiones, comoconsecuencia del robo total del vehculo y de los daos o prdidasmateriales amparados en la cobertura de robo total.

    8. Equipo especial.Se considerar equipo especial cualquier parte, accesorio ortulo instalado a peticin expresa del comprador o propietariodel vehculo, en adicin a las partes o accesorios con los que elfabricante adapta originalmente cada modelo y tipo especficoque presenta al mercado.

    Cobertura:De ser contratada esta cobertura, se cubre el equipo especialbajo las mismas coberturas que aparezcan en la cartula de lapliza como contratadas por el vehculo asegurado. Daosmateriales y / o robo total, de acuerdo a sus mismas bases yexclusiones.

    La descripcin de los bienes asegurados y a la suma aseguradapara cada uno de ellos, deber asentarse mediante anexo, y enningn caso la indemnizacin exceder del valor comercial quetengan dichos bienes a la fecha del siniestro.

    Bienes Asegurados:Accesorios y partes instalados en adicin a los instalados originalmente por el fabricante, INCLUYE BLINDAJE

    Riesgos Cubiertos:Dao al equipo especial a consecuencia de robo total o daos materiales

    Suma Asegurada:El valor comercial a la fecha de contratacin de la pliza

    Deducible:Quedar a cargo del asegurado el 25% del valor de los bienes afectados por el siniestro.

    robo total o daos materialesSuma Asegurada:El valor comercial a la fecha de contratacin de la plizaDeducible:El de daos materiales o robo total (lo que provoc el siniestro)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES

    9. Territorialidad:

    Las coberturas amparadas por esta pliza, seaplicarn en caso de accidentes ocurridos dentro dela Repblica Mexicana. La aplicacin de lascoberturas amparadas se extiende a los EstadosUnidos de Norteamrica y Canad, con excepcinde las coberturas de Responsabilidad Civil,Extensin de Responsabilidad Civil y AsistenciaLegal.

    TERRITORIALIDAD

    COBERTURA COBERTURA PAQUETE DE

    PAQUETES COMERCIALES DE COBERTURAS

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT149

    COBERTURA AMPLIA

    COBERTURA LIMITADA

    PAQUETE DE RESP. CIVIL

    DAOS MATERIALES XROBO TOTAL X XRESPONSAB.CIVIL X X XGASTOS MEDICOS OCUPANTES X X X

    EQUIPO ESPECIAL OPCIONAL

    ADAPTACIONES Y CONVERSIONES

    OPCIONAL

    EXTENSION DE RESP. CIVIL.

    OPCIONAL

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES

    10. Beneficios o Asistencias:Asistencia mdica en viajesAsesora legal en viajesAsistencia en viajesAsistencia mecnica en viajesMantenimiento del vehculo en viajesArrastre en viajes9. Exclusiones1.Lesiones o muerte del conductor cuando el vehculo

    asegurado participe en contiendas pruebas de seguridad,de resistencia o velocidad.

    2.A conductores en motocicletas.3.Lesiones o muerte del conductor cuando el vehculo

    asegurado sea utilizado en el servicio militar de cualquierclase; actos de guerra, insurreccin, rebelin, revolucin,actos delictuosos o intencionales en que participedirectamente el conductor y ria provocada por parte delconductor del vehculo amparado.

    4.Lesiones o muerte que el conductor sufra cuando el

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Beneficio ServicioAsistenciamdica enviajes

    Traslado en ambulancia por haber sufrido un accidente o enfermedad durante el viaje.

    Asesora legalen viajes

    Asesora de trmite legal que necesite el asegurado, levantar actas en el MP, trmite de pasaporte en el extranjero.

    Asistencia enviajes

    Ayuda ante percance en un viaje como hospedaje por algn accidente, prdida de transporte, descompostura de vehculo, enfermedad o muerte del asegurado.Asesora sobre trmites aduanales, lugar de inters para visitar, horarios de transporte, reservaciones de hotel.

    Asistenciamecnica enviajes

    Envo de un mecnico que ayuda a determinar el desperfecto y si se puede lo arregla en ese momento

    Mantenimiento del vehculoen viajes

    Asesora sobre talleres mecnicos cercanos, agencias para dar mantenimiento al vehculo.

    Arrastre enviajes

    Envo de gra al lugar donde se encuentre el vehculo y traslado a un taller mecnico.

    CCCC

    CCCCGGGGCTCTCTCTTTTT150

    4.Lesiones o muerte que el conductor sufra cuando elvehculo asegurado sea utilizado con fines de suicidio ocualquier intento del mismo, an cuando el conductor seencuentre en estado de enajenacin mental.

    5.Lesiones o muerte que el conductor sufra cuando elasegurado no le hubiere otorgado su consentimientoexpreso o tcito para utilizar el vehculo.

    6.Lesiones o muerte que se produzcan en el conductor delvehculo asegurado cuando el mismo carezca de licenciadel tipo apropiado para conducir el vehculo asegurado,expedida por autoridad competente al menos que nopueda ser imputada al conductor culpa, impericia onegligencia graves en la realizacin del siniestro.

    11.Exclusiones Especficas decoberturas bsicas:.

    Daos MaterialesCristalesRobo TotalR.C. BienesR:C: PersonasGastos Mdicos Ocupantes

    DaosMateriales

    Daos menores al monto del deducibleFallas mecnicas, abuso de confianza por familiar o no del asegurado, daos a pintura por otras causas a los Riesgos Meteorolgicos desbielamiento, robo parcial, accin normal de la marea.

    Cristales Rotura de espejos laterales, calaveras, faros, ni cristales que no sean instalados originalmente.

    Robo Total Fraude, abuso de confianza de familiar o no, por compra-venta del vehculo, arrendamiento, crdito o financiamiento

    R.C. Bienes Daos a bienes en custodia, propiedad de dependientes civiles, bienes dentro del vehculo, fianzas, caucin,daos por carga y descarga

    R:C:Personas

    Daos a personas mal intencionadas, ocupantes del vehculo, dependientes civiles, uso de vehculo diferente

    GastosMdicosOcupantes

    Exclusiones generales de la pliza

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES

    12. Exclusiones Especficas para Coberturas AccesoriasEquipo especialAdaptaciones y ConversionesExtensin de Responsabilidad CivilSUVAAsistencia legal

    13. Riesgos NO amparados por elContrato, pero que pueden ser cubiertosmediante convenio expreso:

    Daos que sufra o cause el vehculo a consecuencia de:a)Destinarlo a un uso o servicio diferente al indicado enesta pliza, que implique una agravacin del riesgo.b)El arrastre de remolques. En caso de tractocamiones,el sistema de arrastre para el segundo remolque (dolly),as como el segundo remolque.c)Utilizarlo para cualquier tipo de enseanza.d)Participar directa o indirectamente con el vehculo, en

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Equipo especial Las exclusiones de las coberturas de daos materiales y de robo total

    Adaptaciones y Conversiones Las exclusiones de las coberturas de daos materiales y de robo totalExtensin de Responsabilidad Civil

    Cuando el asegurado o conductor maneje un automovil de renta diaria, camiones de ms de 3 toneladas, autobuses o transporte pblico.

    SUVA Las exclusiones de resposabilidad civil personas y bienes

    Asistencia legal No cubre gastos por riesgos no amparados, delitos de abuso de confianza o fraude.

    RIESGOS AMPARADOS MEDIANTE CONVENIO EXPRESO

    CCCC

    CCCCGGGGCTCTCTCTTTTT151

    d)Participar directa o indirectamente con el vehculo, encarreras o pruebas de seguridad, resistencia ovelocidad.1.Responsabilidad Civil por daos por la carga. La responsabilidadcivil del asegurado por daos a terceros en sus bienes o personas,causados con la carga que transporte el vehculo, cuando statenga caractersticas de peligrosa, como la que a continuacin seseala:

    Carga tipo B: maquinaria pesada, vehculos a bordo de camiones,tronco o trozos de madera, rollo de papel, cable o alambre para usoindustrial, postes, varillas, viguetas de acero, materiales, partes omdulos para la industria de la construccin, ganado en pie osimilares.Carga tipo C: mercanca altamente peligrosa, tal como sustancias

    y/o productos txicos y/o corrosivos, inflamables y/o explosivos, ocualquier otro tipo de carga similar a las enunciadas.3.Responsabilidad Civil Ecolgica o daos por contaminacin.Comprende daos por contaminacin y/o al medio ambiente, ascomo los gastos de limpieza por la contaminacin que se ocasione.4.Los gastos de defensa jurdica del conductor del vehculo, conmotivo de los procedimientos penales originados por cualquieraccidente, y el costo de fianzas o cauciones de cualquier clase, ascomo sanciones, perjuicios o cualesquiera otras obligacionesdistintas de la reparacin del dao material que resulte a cargo delasegurado.

    Daos que sufra o cause el vehculo a consecuencia de:

    a) Destinarlo a un uso diferente.b) Arrastre de remolques.c) Utilizarlo para enseanza.d) Participar en carreras, pruebas

    de seguridad, resistencia o velocidad.

    Carga Tipo B:Maquinaria pesada, troncos, rollo de papel, cable, alambre, postes, varillas, etc.

    Carga Tipo C:Mercanca altamente peligrosa, productos txicos, corrosivos, inflamables, explosivos, etc.

    Responsabilidad Civil por Daos por la Carga

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    2. DeduciblesEl deducible es la participacin a cargo del asegurado en caso derobo total, parcial, por responsabilidad civil o por equipo especial,cuando ocurre un siniestro.Normalmente para automviles el deducible por daos materialeses el 5% y en Robo es del 10%.

    3.- Primas.La prima vence y deber ser pagada al momento de la celebracindel contrato.En caso de siniestro que implique la prdida total del vehculo, lacompaa deducir de la indemnizacin debida al Asegurado ocontratante el total de la prima pendiente de pago del riesgoafectado, hasta completar la prima correspondiente al periodo ovigencia de seguro contratado.

    Devolucin de Primas: Prdida TotalHay Instituciones Aseguradoras que devuelven el 100% del importede la prima, correspondiente a las coberturas de daos materiales,robo total, responsabilidad civil, y gastos mdicos de los ocupantes,por el perodo pagado, incluyendo la prima devengada, hasta elmomento del siniestro, sin distinguir coberturas afectadas o no.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    V1.3 SINIESTROS

    DEDUCIBLEEs la participacin a cargo del asegurado en caso derobo total, parcial, o por equipo especial, cuando ocurrael siniestro

    Daos Materiales5% - 10%

    Robo total10% - 20%

    DEVOLUCION DE PRIMAS

    No devengadasde las coberturas contratadas y no

    afectadas

    Cuando sea considerada prdida total

    CCCC

    CCCCGGGGCTCTCTCTTTTT152

    En caso de siniestro, el asegurado se obliga a realizarlas siguientes acciones:

    A. Ejecutar todos los actos que tiendan a evitar o disminuirel dao.Si no hay peligro en la demora, pedir instrucciones a la Compaa,debiendo abstenerse a las que ella le indique. Los gastos hechospor el asegurado, que no sean manifiestamente improcedentes, secubrirn por la compaa y si sta da instrucciones, anticipar losgastos.Si el asegurado no cumple con las obligaciones que le impone elprrafo anterior, la Compaa tendr derecho de limitar o reducir laindemnizacin, hasta el valor a que hubiere ascendido si elasegurado hubiere cumplido con dichas obligaciones.B. Aviso de siniestro.Dar aviso a la compaa tan pronto como tenga conocimiento del

    hecho, salvo en casos de fuerza mayor. La falta oportuna de esteaviso solo podr dar lugar a que la indemnizacin sea reducida a lacantidad que originalmente hubiere importado el siniestro, si laCompaa hubiere tenido pronto aviso sobre el mismo.C. Aviso a las autoridades.

    Presentar formal querella o denuncia ante las autoridadescompetentes, tan pronto como tenga conocimiento de los hechos,cuando se trate de robo u otro acto delictuoso que pueda sermotivo de reclamacin al amparo de la pliza, as como cooperarcon la compaa para conseguir la recuperacin del vehculo o delimporte de los daos sufridos. En caso de que el Asegurado seniegue injustificadamente a lo anterior, resarcir a la Compaa delos daos y perjuicios ocasionados

    V1.3 SINIESTROS

    SINIESTROS

    En caso de siniestro, el aseguradose obliga a realizar las siguientesacciones:

    A.Ejecutar todos los actos que tiendan aevitar o disminuir el dao.

    B. Aviso de siniestro.C. Aviso a las autoridades.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES

    Adicionalmente a lo anterior, el Asegurado seobliga a:

    A. Aviso de Reclamacin:El asegurado se obliga a comunicar a la Compaa, tan prontotenga conocimiento, sobre las reclamaciones o demandasrecibidas por l o por sus representantes, a cuyo efecto le remitirlos documentos o copia de los mismos, que con ese motivo sehubieren entregado.La falta de cumplimiento a esta obligacin por parte delAsegurado, liberar a la compaa de cubrir la indemnizacin quecorresponda a la cobertura afectada por el siniestro.Compaa no quedar obligada por reconocimiento de adeudos,transacciones o cualesquiera otros actos jurdicos de naturalezasemejante, hechos o concertados sin consentimiento de ella. Laconfesin de la materialidad de un hecho no podr ser asimiladaal reconocimiento de una responsabilidad.

    B. Cooperacin y asistencia del Asegurado con respecto a laCompaa:

    El asegurado se obliga a costa de la compaa, en todoprocedimiento civil que pueda iniciarse en su contra, con motivo

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    SINIESTROS

    Adicionalmente a lo anterior, el Asegurado se obliga a:

    A.Aviso de Reclamacin.- El asegurado se obliga acomunicar a la Compaa, tan pronto tenga conocimiento,sobre las reclamaciones o demandas recibidas por l opor sus representantes, a cuyo efecto le remitir losdocumentos o copia de los mismos, que con ese motivose hubieren entregado.

    B. Cooperacin y asistencia del Asegurado conrespecto a la Compaa:A proporcionar los datos y pruebas necesarios, que lehayan sido requeridos por la Compaa para su defensaa costa de sta, en caso de ser necesaria, o cuando elasegurado no comparezca.

    CCCC

    CCCCGGGGCTCTCTCTTTTT153

    procedimiento civil que pueda iniciarse en su contra, con motivode la responsabilidad cubierta por el seguro: A proporcionar los datos y pruebas necesarios, que le hayansido requeridos por la Compaa para su defensa a costa de sta,en caso de ser necesaria, o cuando el asegurado no comparezca.A ejercitar y hacer valer las acciones y defensas que lecorrespondan en derecho.A otorgar poderes a favor de los abogados de la compaadesigne para que lo representen en los citados procedimientosciviles, en caso de que no pueda intervenir en forma directa entodos los trmites de dichos procedimientos.

    Obligacin de comunicar la existencia de otrosseguros:

    El asegurado tendr la obligacin de poner inmediatamente enconocimiento de la compaa, por escrito la existencia de todoseguro que contrate o hubiere contratado contra compaa, sobreel mismo riesgo y por el mismo inters, indicando el nombre delAsegurador y las coberturas contratadas.

    A ejercitar y hacer valer las acciones y defensas que lecorrespondan en derecho.A otorgar poderes a favor de los abogados de lacompaa designe para que lo representen en los citadosprocedimientos civiles, en caso de que no puedaintervenir en forma directa en todos los trmites de dichosprocedimientos.

    AVISO POR ESCRITO Y MANIFESTAR S.A.

    OMISIN DE AVISO POR ESCRITO Y LA CIA. QUEDA LIBRE DE OBLIGACIN

    Cuando se contrate un segurocon varias empresas queamparen el mismo bien contralos mismos riesgos, elasegurado tendr obligacinde poner en conocimiento decada uno de los aseguradoresla existencia de otros seguros.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    AUTOMOVILES

    5. Asistencia Legal.

    Para la asistencia legal se tiene:

    Los servicios profesionales de un cuerpo de abogadosespecializados durante las 24 horas los 365 das del ao,encaminados fundamentalmente a obtener la libertad delconductor, as como a tramitar ante autoridadescorrespondientes la liberacin del vehculo asegurado, encaso de la ocurrencia de un accidente automovilstico en quese ocasionen daos a terceros en sus bienes o sus personas.

    El otorgamiento de la prima de la fianza o garanta de dineroen efectivo, que como caucin fije el Ministerio Pblico oautoridad judicial competente, para conceder la libertadprovisional del conductor, si sta procede y la liberacin delvehculo asegurado. Se incluye el pago de cualquiererogacin que legalmente proceda, con excepcin del pagode multas o faltas administrativas, salvo por lo sealado en elpunto 4 siguiente.

    Los servicios profesionales de un cuerpo especializado deabogados, encaminados a asesorar al Asegurado, a surepresentante o al conductor del vehculo, en la presentacinde las denuncias necesarias por el robo total de la unidadasegurada en su caso, en los trmites para lograr la

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Cuerpo de abogados las 24 hrs. Del ao, para obtener la libertad, tramitar la liberacin del vehculo asegurado (en caso de que haya daos a terceros ) Otorgamiento de la prima de la fianza o garanta de dinero en efectivo, para la libertad del asegurado. Servicio de abogados para asesoramiento del asegurado o conductor del vehculo, en las denuncias por robo total del automvil o trmites para la devolucin del mismo, ante autoridad competente. Si a consecuencia del accidente , el conductor quedara sujeto a un proceso civil y / o penal, La asistencia legal se constituir en:a.Elementos que favorezcan la defensae interponiendo los recursos necesarios , an el juicio de amparo, hasta obtener el fallo final de los jueces,

    ASISTENCIA LEGAL

    CCCC

    CCCCGGGGCTCTCTCTTTTT154

    asegurada en su caso, en los trmites para lograr ladevolucin del vehculo si ste fuese localizado por laautoridad.

    Si a consecuencia del accidente , el conductor quedara sujetoa un proceso civil y / o penal, La asistencia legal se constituira travs de sus abogados especialistas en su defensa,aportando en el proceso todos aquellos elementos quefavorezcan, e interponiendo los recursos necesarios , an eljuicio de amparo, hasta obtener el fallo final de los jueces, lacompaa absorber los honorarios y gastos que se originenen el procedimiento hasta su terminacin, incluyendo el pagode las multas penales impuestas por el juez as como lacantidad que como pena conmutativa deba pagar elasegurado en el caso de una sentencia condenatoria, hasta ellmite de suma asegurada contratada en esta cobertura.

    6. Partes del automvil que est sujetosa demrito:

    Las partes que estn sujetas a demrito son: El motor del coche. Las llantas. El acumulador. Partes elctricas, etc.

    PARTES DEL AUTOMOVIL QUE ESTAN SUJETAS A DEMERITO:

    MOTOR LLANTAS ACUMULADOR PARTESELECTRICAS

    fallo final de los jueces, b.La compaa absorber los honorarios y gastos que se originen en el procedimiento hasta su terminacin, incluyendo:1.- Pago de las multas penales impuestas por el juez as como 2.- Cantidad que como pena deba pagar el asegurado en el caso de una sentencia condenatoria, hasta el lmite de suma asegurada contratada en esta cobertura.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    ALCANCE DE LOS SERVICIOS DEL AJUSTADOREl ajustador es el intermediario que al servicio de laaseguradora, con carcter profesional se dedica a ladeterminacin o tasacin de las consecuenciaseconmicas, derivadas de un siniestro a fin de que laentidad aseguradora, en base a su informe, determine elimporte de lo indemnizacin correspondiente.

    INDEMNIZACIONES

    BASE PARA LA DETERMINACION DE LA PERDIDATOTAL Y PERDIDA PARCIAL

    PERDIDA PARCIALSi en monto de la reparacin en menor el 50% siempre seconsidera como prdida parcial

    PERDIDA TOTALSi en monto de la reparacin supera el 50% siempre se considera

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    PRDIDA PARCIAL Si en monto de la reparacinen menor el 50% siempre seconsidera como prdida parcial

    INDEMNIZACIONES

    ALCANCE DE LOS SERVICIOS DEL AJUSTADOR

    Determinacin o tasacin de las consecuencias econmicas, derivadas de un siniestro a fin de que la entidad aseguradora, en base a su informe, determine el importe de lo indemnizacin correspondiente

    CCCC

    CCCCGGGGCTCTCTCTTTTT155

    Si en monto de la reparacin supera el 50% siempre se consideracomo prdida totalEn caso de un siniestro, el asegurado tiene la opcin de declararprdida total o parcial, siempre que el costo total de la reparacineste entre el 50% y 75% del valor comercial inmediato anterior alsiniestro.

    Para efectos de cualquier indemnizacin bajo las coberturas deDaos Materiales o de Robo Total, la suma asegurada ser igual alvalor comercial del vehculo al momento del siniestro, o en su caso,la cantidad especificada en la pliza como suma asegurada.

    Para efectos de cualquier indemnizacin bajo las coberturas deDaos Materiales Catastrficos , la suma asegurada ser igual al90% del valor comercial del vehculo al momento del siniestro.

    La indemnizacin de las prdidas parciales comprender el valorfactura de refacciones y mano de obra, ms los impuestos que ensu caso generen los mismos. En todo caso, hacerse la valuacin alpblico de refacciones o accesorios en la fecha del siniestro.

    PAGO DE TENENCIAS

    DAOS MATERIALES CATASTROFICOS

    LA SUMA ASEGURADA ES IGUAL AL 90% VALOR COMERCIAL DEL VEHICULO

    PRDIDA TOTALReparacin supera el 50%Siempre que el costo total de la reparacin este entre

    el 50% y 75% del valor comercial inmediato anterior al siniestro

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT156

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Riesgos que corren las familias en susbienesUna familia tiene una infinidad de objetos de

    su propiedad, mismos que le son necesarios yalgunos de ellos indispensables para llevaruna vida digna y cmoda, por ejemplo sucasa, su ropa, sus muebles, su automvil, etc.Antiguamente se aseguraban los objetos porseparado, y tambin se consideraban losdiferentes riesgos en forma aislada, lo quehaca verdaderamente difcil y costosa laadministracin de los contratos de seguros,tanto para la propia familia contratante comopara la aseguradora.

    Por esta razn se cre la pliza MltipleFamiliar en la que se engloban los principalesriesgos para todos los bienes que posee unafamilia normalmente.CONCEPTOS BASICOS:

    Avalos de Bienes de AseguramientoEspecialObras de arte, artculos raros o de difcilreposicin, antiguedades, mquinasobsoletas, requieren avalo para determinarla suma asegurada.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    VII.1 CONCEPTOS BASICOS

    SEGURO PROPORCIONAL

    Salvo convenio en contrato, sila suma asegurada es inferioral inters asegurado, laempresa aseguradoraresponder de maneraproporcional al dao causado.

    SEGURO A PRIMER RIESGO

    No es obligatorio asegurar elvalor total de los bienes. Elcontratante puede aseguraruna parte del valor total. Hastadonde alcance la sumaasegurada, sin tomar encuenta la proporcionalidad.

    SOBRESEGURO Cuando un objeto ha sido asegurado por un valor superior al que tiene.

    CCCC

    CCCCGGGGCTCTCTCTTTTT157

    la suma asegurada.Valor RealSe entiende por valor real de un bienasegurado el Valor de Reposicin del mismo,menos la depreciacin correspondiente.Valor de ReposicinSe entiende por valor de reposicin, lacantidad que exigir la adquisicin de un biennuevo de la misma clase y capacidadincluyendo el costo de transporte, montaje yderechos aduanales, si los hay.Valor ConvenidoEs aquel que fijan de comn acuerdo elcontratante y la compaa aseguradora.INDEMNIZACIN:Se relaciona con la forma en que seestablece la suma asegurada.Seguro a Primer RiesgoSe llama as a la cobertura en donde NO esobligatorio asegurar el valor total de losbienes, el asegurado puede asegurar unaparte del valor total. Pero cuando ocurra elsiniestro, se le pagar el dao hasta dondealcance la suma aseguradaSeguro ProporcionalSalvo convenio en contrato, si la sumaasegurada es inferior al inters asegurado, laempresa aseguradora responder de maneraproporcional al dao causado.

    superior al que tiene.

    RIESGOS NOMBRADOS

    Quedan cubiertos aquellos riesgos que se nombran de manera explcita

    TODO RIESGO Los bienes quedarn amparados contra cualquier prdida o dao relacionado con el ramo contratado

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CONTRATACIN DE LA COBERTURATodo RiesgoAlgunas Instituciones ofrecen esta cobertura a

    cambio de una tarifa ms elevada. Los bienesquedarn amparados como prdida o dao porcualquier riesgo sbito o imprevisto que no seencuentre expresamente excludo en la pliza.Riesgos NombradosEl asegurado elige las coberturas que quierecontratar y sas son slo las que aparecenexpresamente en la pliza.

    COBERTURA BSICA:Daos que sufran los bienes a consecuenciade Incendio o rayo.

    BIENES ASEGURABLES DE LA POLIZADE EDIFICIO;Construccin.- Conjunto de edificaciones yprincipales accesorias, con sus instalaciones fijas(agua, luz, electricidad, calefaccin), excluyendolos cimientos y los aditamentos que seencuentrenen en el nivel ms abajo del piso

    SECC I ONES

    HOGAR

    INCENDIO DIVERSOS

    I. Incendio en Edificio

    II. Incendio de los Contenidos

    III.Terremoto en Edificios

    IV.Terremoto en Contenidos

    RESPONSABILIDAD CIVIL

    Responsabilidad Civil FamiliarResponsabilidad Civil arrendatario

    Robo con violencia en domicilioRotura de cristalesEquipo electrodomsticoDinero y Valores

    POLIZA MULTIPLE FAMILIAR

    ACCIDENTES PERSONALES

    ESTRUCTURA DE LA POLIZA HOGAR

    Daos que sufran los bienes a consecuencia de Incendio o rayo

    VII.2 ESTRUCTURA DE LA PLIZA

    CCCC

    CCCCGGGGCTCTCTCTTTTT158

    encuentrenen en el nivel ms abajo del pisoMuros: De piedra, tabique, block de concreto,tepetate, adobe, o concreto armado.Entrepisos: De bveda metlicas, bovedillas,siporex, losa, acero, tridilosa, bveda de ladrillosobre armazn de hierro o cemento armado.Techos: De tabique, bovedillas, siporex, placasde materiales aglutinados resistentes al fuegocuando menos por dos horas, losa de acero,tridilosa, etc.

    BIENES ASEGURABLES DE LA POLIZADE CONTENIDO;Menaje de CasaSe entender por menaje de casa: los contenidospropios de la casa habitacin como enseresdomsticos, muebles, ropa, aparatoselectrodomsticos, artculos de arte, decorativos,y deportivos.

    La construccin material del edificio sin considerar el valor delterreno, ni los cimientos.

    ConstruccinMurosTechosInstalaciones elctricasInstalaciones hidrulicasInstalaciones sanitariasEn edificios en condominio la cobertura comprende la participacindel asegurado en reas comunes: Pasillos, escaleras, elevadoresetc.

    Mueblestiles de cocinaEnseresAccesoriosObjetos de decoracinArtculos deportivosRopa de uso personalAparatos electrodomsticos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE INCENDIO yRIESGOS ADICIONALES

    (EDIFICIO Y CONTENIDOS)Los bienes cubiertos quedan amparados, contraprdidas o daos materiales causados directamentepor cualquier riesgo sbito, accidental e imprevisto, elcual no forme parte de las exclusiones sealadas enesta pliza. De manera enunciativa, pero no limitativa,dichos riesgos son:

    Incendio, rayoExplosin.- Ya sea que se origine dentro o fuera dela casa asegurada. Se excluyen los daos que por supropia explosin, sufran las calderas o recipientessujetos a presin ya que solamente se cubrirn si supliza cuenta con una seccin para cubrir las calderasy aparatos sujetos a presin.Cicln, huracn, granizo, vientostempestuosos.-Esta cobertura excluye lasmojaduras por filtraciones ( a menos que los vientos oel granizo rompan techos, muros, puertas o ventanas).Asimismo, se excluyen daos a edificios (o suscontenidos) que carezcan de uno o ms de sus muros,techos, puertas o ventanas. Plantas, prados, jardines ybienes a la intemperie se encuentran igualmenteexcludosHuelgas y alborotos populares.- Se cubren losdaos materiales que sufran los bienes asegurados

    I. Incendio, rayoII. ExplosinIII. Huracn, Granizo, cicln,IV. Vientos tempestuososV. Huelgas y alborotos popularesVI. InundacinVII. Naves areas ,vehculos y humo.VIII. Extensin de cubierta Cada de rboles sus ramas Cada de antenas (parablicas o de

    radio no comercial) Obstruccin en las bajadas pluviales

    a causa de acumulacin de granizo. Descargas, derrames, filtraciones

    I. Remocin de EscombrosII.Gastos ExtraodinariosIII.Cobertura a todo Riesgo

    INCENDIO Y/O RAYO

    Cubre la indemnizacin a consecuencia de un Incendio y/ o rayo, enedificios, mquinas, aparatos o instalaciones que utilicen o produzcancorriente elctrica como transformadores, cuando dichos daos seancausados directamente por las corrientes elctricas ya sean naturales oartificiales. Generalmente sta es la cobertura bsica.

    EXPLOSIN Ya sea que se origine dentro o fuera de la casa asegurada. Se excluyenlos daos que por su propia explosin, sufran las calderas o recipientessujetos a presin ya que solamente se cubrirn si su pliza cuenta conuna seccin para cubrir las calderas y aparatos sujetos a presin.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT159

    daos materiales que sufran los bienes aseguradospor: Huelguistas o personas que tomen parte en paros,mtines, disturbios de carcter obrero o alborotospopulares, o por las autoridades al reprimir dichosactos; Vndalos o personas mal intencionadas, fuerade los casos de huelgas o alborotos popularesInundacin.-Cubre los daos por inundacin,siempre y cuando sta sea el cubrimiento temporalaccidental del suelo por agua, provocado por eldesbordamiento, desviacin o rotura de muros decontencin, ros, canales, lagos, presas, estanques ydems corrientes o depsitos de agua, ya seannaturales o artificiales.Naves areas ,vehculos y humo. Cubre losdaos ocasionados por colisin de naves areas uobjetos cados de ellas, Colisin de vehculos, Humo otizneExtensin de cubierta

    Cada de rboles sus ramas, exceptocuando se trate de podas o talasefectuadas por el asegurado o susdependientes.

    Cada de antenas (parablicas o de radiono comercial)

    Obstruccin en las bajadas pluviales acausa de acumulacin de granizo.

    Descargas, derrames, filtraciones odemasias accidentales de los sistemas,depsitos instalaciones de agua o devapor, as como los daos causados porrotura accidental de las tuberas.

    HURACAN, GRANIZO, CICLON

    VIENTOS TEMPESTUOSOS

    Esta cobertura excluye las mojaduras por filtraciones ( a menos que losvientos o el granizo rompan techos, muros, puertas o ventanas).Asimismo, se excluyen daos a edificios (o sus contenidos) quecarezcan de uno o ms de sus muros, techos, puertas o ventanas.Plantas, prados, jardines y bienes a la intemperie se encuentranigualmente excludos. Excepto Inundacin o marejada

    HUELGAS Y ALBOROTOS POPULARES

    Se cubren los daos materiales que sufran los bienes asegurados por:Huelguistas o personas que tomen parte en paros, mtines, disturbiosde carcter obrero o alborotos populares, o por las autoridades alreprimir dichos actos; Vndalos o personas mal intencionadas, fuera delos casos de huelgas o alborotos populares.Excepto robo por personaldel asegurado o terceras personas en los actos mencionado

    NAVES AEREAS, VEHICULOS Y

    HUMO

    Cubre los daos ocasionados por colisin de naves areas u objetoscados de ellas, Colisin de vehculos, Humo o tizne Excepto: Humo otizne de chimeneas o aparatos domsticos o industriales

    INUNDACIONCubre los daos por inundacin, siempre y cuando sta sea elcubrimiento temporal accidental del suelo por agua, provocado por eldesbordamiento, desviacin o rotura de muros de contencin, ros,canales, lagos, presas, estanques y dems corrientes o depsitos deagua, ya sean naturales o artificiales. Excepto:lluvia, nieve,granizopor desague o falta de los mismos,hundimiento o derrumbes.

    EXTENSIN DE CUBIERTA

    Integra todas las coberturas anteriores e incluye adicionalmente: Descargas, derrames, filtraciones o demasias accidentales de

    los sistemas, depsitos o instalaciones de agua o de vapor, ascomo los daos causados por rotura accidental de las tuberias.

    Cada de rboles o sus ramas, excepto cuando se trate depodas o talas efectuadas por el asegurado o susdependientes.Excepto: podas,corte ramas realizadas por elasegurado

    Cada de antenas (parablicas o de radio no comercial) Obstruccin en las bajadas pluviales a causa de acumulacin de

    granizo.

    Excepto: Marejada, Inundacin,mojadura o filtracin de agua al interior edificio o contenidos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Coberturas AdicionalesRemocin de escombrosSe pagarn los gastos necesarios porconcepto de demolicin limpieza y acarreo deescombros, con motivo de un siniestroamparado.Debe fijarse un lmite de suma aseguradaespecfica para este concepto. Normalmente,es de un 20 % sobre la suma aseguradabsica.Gastos extraordinarios (prdidasconsecuenciales)Posteriormente a un siniestro puede ser que elasegurado necesite vivir provisionalmente en otrositio, mientras se realizan los trabajos de reparacin.Esta cobertura pagar los gastos de mudanzas,almacenaje de bienes y rentas de casa,departamento, hotel o casa de huspedes.La suma asegurada para esta cobertura puedeexpresarse como una cantidad o como un porcentajede la suma asegurada bsica. El perodo amparadopuede ir de 1 a 12 meses.

    Cobertura a Todo Riesgo. Se cubre tododao excepto lo expresamente expresamentedescrito en las exclusiones y en lascoberturas adicionales, si no se contrata.

    BIENES EXCLUIDOS DE LA POLIZADE EDIFICIOS Y CONTENIDO

    PLIZA MLTIPLE FAMILIAR

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    COBERTURAS ADICIONALES

    Mquinas, aparatos o accesorios que se emplean para producir, transformar o utilizar corrientes elctricasTtulos, obligaciones o documentos de cual quierclase, timbres postales o fiscales, monedas, billetesde banco, cheques, letras, pagars, libros decontabilidad u otros libros de comercio.Fermentacin o vicio propio

    I. Remocin de Escombros.-Ampara el costo de remover los escombros ocasionados por un riesgo amparado, remover incluye desmontaje, demolicin,acarreos y limpeza del predio para volver a construir lo daado.

    I. Gastos Extraodinarios.-Renta de casa o departamento, casa de huspedes u hotel. Mudanza, seguro de transportes de menaje de casa y almacenaje del mismo

    I. Cobertura a todo Riesgo.-Cubre todo riesgo excepto las exclusiones

    CCCC

    CCCCGGGGCTCTCTCTTTTT160

    DE EDIFICIOS Y CONTENIDOMquinas, aparatos o accesorios que seemplean para producir, transformar o utilizarcorrientes elctricas, cuando dichos daossean causados, por corrientes normales ocorrientes en el sistema, cualquiera que seala causa ( interna o externa).Ttulos, obligaciones o documentos de cualquier clase, timbres postales o fiscales,monedas, billetes de banco, cheques, letras,pagars, libros de contabilidad u otros librosde comercio.Fermentacin y vicio propio por cualquierprocedimiento de calefaccin o desecacin amenos que los procedimientos seaninterrumpidos como consecuencia decualquier riesgo amparado,Dolo o mala fe de las personasDolo de bienes ocurridos durante elsiniestro

    BIENES QUE PUEDEN CUBRIRSEMEDIANTE CONVENIO EXPRESO: Objetos raros o de arte, artculos de difcillo imposible reposicinManuscritos, planos, croquis, patrones,modelos o moldes, lingotes de oro y plata,alhajas y pedrera que no est montada.RIESGOS QUE PUEDEN CUBRIRSEMEDIANTE CONVENIO EXPRESO: Remocin de escombros

    Fermentacin o vicio propioDolo y mala fe personas y bienes

    BIENES RIESGOS

    Objetos raros o de arte, artculos de difcill o imposible reposicinManuscritos, planos, croquis, patrones, modelos o moldes, lingotes de oro y plata, alhajas y pedrera que no est montada.

    Remocin de escombros

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    DETERMINACION DE LA SUMAASEGURADA EN INCENDIO

    Edificio.- VALOR DE REPOSICINde la construccinLas Aseguradoras cuentan con tablas paracalcular este valor, que estan basadas enmetros cuadrados de construccin yconsiderando el tpo de construccin,econmico, medio de lujo.Contenido.- Se establece como unporcentaje de la suma asegurada deledificioLas Aseguradoras cuentan con tablas paracalcular este valor, que estan basadas enmetros cuadrados de construccin yconsiderando el tpo de construccin,econmico, medio de lujo.

    Para la cobertura de INUNDACION,generalmente se considera que la sumaasegurada ser del 80% de la contratada enla cobertura bsica.

    BIENES CUBIERTOS: Edificio y los contenidos.RIESGOS CUBIERTOS: .Cubre todos los daos

    Deducibles y coaseguros aplicables a las coberturas Deducible Coaseguro Edificio y Contenidos Incendio y/o rayo, explosin

    Sin deducible Sin coaseguro

    Extensin de cubierta, excepto explosin

    1% sobre la suma asegurada con mximo de 750 DSMGVDF

    Sin coaseguro

    Inundacin 1% sobre la suma asegurada con mximo de 1,500 DSMGVDF

    20% de la S.A. equivalente al 80%

    Remocin de escombros y Gastos extraordinarios

    Sin deducible Sin coaseguro

    Cicln, huracn, granizo, vientos tempestuosos, huelgas y alborotos. Naves areas, vehculo y humo, Extensin de cubierta (excepto explosin)

    1% sobre la suma asegurada con mximo de 750 DSMGVDF

    Sin coaseguro

    Terremoto Depende zona ssmica Depende zona ssmica

    BIENES CUBIERTOS

    EXCLUSIONES

    Los mismos queampara la cobertura deIncendio.Sin embargo debenmencionarse que paracubrir albercas, bardasy patios exterioresdebern solicitarseexpresamente.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    SECCION DE TERREMOTO Y/O ERUPCION VOLCANICA (EDIFICIOS Y CONTENIDO

    CCCC

    CCCCGGGGCTCTCTCTTTTT161

    RIESGOS CUBIERTOS: .Cubre todos los daosmateriales ocasionados por un terremoto y/oerupcin volcnica.

    BIENES POR CONVENIO EXPRESOAlbercas, bardas, patios exteriores, escalerasexteriores, y cualquiera otras construccionesseparadas del edificio.

    BIENES EXCLUIDOS.Cimientos y muros de contencin debajo del niveldel piso mas bajo, suelos y terrenos.Cualquier clase de frescos o murales.Causados directamente o indirectamente, prximo oremotamente por reacciones nucleares, radiacionesya sean controladas o no y sean o no comoconsecuencia de un terremoto y/o erupcinvolcnica.Por marejada o inundacin.Por vibraciones o movimientos naturales delsubsuelo y que sean ajenas al terremoto(hundimiento o asentamiento del suelo o subsuelo).El costo de mejoras para dar mayor solidez aledificio.

    BIENES EXCLUIDOS.Cimientos y muros de contencin debajo del niveldel piso mas bajo, suelos y terrenos.Cualquier clase de frescos o murales.Causados directamente o indirectamente, prximo oremotamente por reacciones nucleares, radiacionesya sean controladas o no y sean o no comoconsecuencia de un terremoto y/o erupcinvolcnica.Por marejada o inundacin.

    Se pagaran los daos que sufran los bienes asegurados a consecuencia de terremoto y/o erupcin volcnica

    EXCLUSIONES1. Cimientos, muros de contencin, suelos y terreno2. Daos a murales pintados sobre los edificios

    amparados3. Daos causados por reacciones nucleares,

    radiaciones etc.4. Vibraciones o movimientos del suelo(ajenos al

    terremoto)ejem. asentamientos.5. Marejada o inundacin

    Albercas, bardas, patios exteriores, escaleras exteriores, y cualquiera otras construcciones separadas del edificio

    Remocin de escombrosGastos extraordinarios(prdidas consecuenciales)

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    COASEGURO (Participacin de la perdida)Actualmente las compaas clasifican las zonas entres niveles de sismicidad: Alta, Media, y Bajasismicidad.

    DEDUCIBLE.-En toda reclamacin quedar acargo del asegurado un deducible equivalente a unporcentaje de la suma asegurada que depende de lazona ssmica donde se encuentre el bien asegurado.Se aplica un deducible para edificio y otro paracontenido.El deducible se aplica, en su caso, despus de haberrestado el COASEGURO.

    ELEMENTOS DE COTIZACIN DEINCENDIO-TERREMOTOMATERIALES DE CONSTRUCCIONSe requiere conocer los materiales de construccinde muros, entrepisos y techos, los cuales seclasifican como:MACIZOS.- Piedras, tabique, block etc.LIGEROS.- Lminas de asbesto o de metal, etc.NO MACIZOS.- Lmina de plastico, de cartn, de paja, etc.

    NUMERO DE NIVELES.- Se deber informar a la Aseguradora, el nmero de niveles del edificio:SotanosPlanta principalMezzanine

    Deducibles y coaseguros aplicables a las coberturas

    Deducible Coaseguro

    Terremoto y/o erupcin volcnica

    Zona 1 2% sobre la suma

    asegurada Zona 2

    2% sobre la suma asegurada

    Zona 3 3% sobre la suma

    asegurada

    10%

    20%

    30%

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    ELEMENTOS DE COTIZACIN DE INCENDIO-TERREMOTO

    MATERIALES DE CONSTRUCCION

    NUMERO DE NIVELES

    UBICACION

    Se deber informar a laAseguradora, elnmero de niveles deledificio:

    Stanos Planta principal

    Es evidente que existe mayorriesgo de huracn en lascostas que en el interior de lamasa continental. De igualmanera, todos sbemos que elriesgo de terremoto es mayoren el centro del D.F.que enMrida Yucatn Monterrey.

    Se requiere conocer losmateriales de construccin demuros, entrepisos y techos,los cuales se clasifican como:

    MACIZOSPiedras, tabique, block etc.

    CCCC

    CCCCGGGGCTCTCTCTTTTT162

    Pisos altos

    Construccin en las azoteas

    UBICACIN.- Es evidente que existe mayor riesgo de huracn en las costas que en el interior de la masa continental. De igual manera, todos sbemos que el riesgo de terremoto es mayor en el centro del D.F.que en Mrida Yucatn Monterrey.En particular (Acapulco, Guadalajara y el D.F.) estncompuestas por diferentes zonas ssmicas, por locual, la ubicacin deber describirse con la mayorexactitud.

    DETERMINACION DE LA SUMAASEGURADA EN TERREMOTO

    Edificio y Contenido.- Se cubre un porcentaje de la suma asegurada.

    Planta principal Mezzanine

    Pisos altos

    Construccin en lasazoteas

    en el centro del D.F.que enMrida Yucatn Monterrey.En particular (Acapulco,Guadalajara y el D.F.) estncompuestas por diferenteszonas ssmicas, por lo cual, laubicacin deber describirsecon la mayor exactitud.

    Piedras, tabique, block etc.

    LIGEROSLminas de asbesto o de metal,etc.

    NO MACIZOSLmina de plastico, de cartn,de paja, etc.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    INCISO 1A. Como son muebles, enseres, artculos de uso

    domstico, ropa y efectos personales. B. Artculos artisticos, deportivos, electrnico y de difcil

    SECCION DE DIVERSOS

    SECCION DE ROBO CON VIOLENCIACobertura Bsica: Robo con violencia, cuando existeviolencia visible del exterior al interiorinmueble asegurado. Daos materiales al inmueble o mueblespor el robo o intento del mismo. Si alefectuarse el robo se daan paredes,ventanas, puertas o instalaciones de lacasa, o se rompen muebles o aparatoselectrodomsticosASALTO.- Violencia fsica o moral hacia laspersonas que tienen en su poder losbienes y se encuentran dentro o paraadentrarse al inmuebles asegurado.

    Bienes cubiertos:Se cubren los bienes contenidos dentro de lacasa-habitacin, descrita en la especificaciny/o cartula de la pliza, propiedad delAsegurado o de cualquier miembropermanente de su familia, sirviente o huspedque no pague manutencin o alojamiento;siempre y cuando dichos bienes sean de usodomstico o familiar.

    I. Robo con violenciaII. Daos materiales al inmuebles o

    muebles por robo o intento

    CCCC

    CCCCGGGGCTCTCTCTTTTT163

    BIENES CUBIERTOS

    B. Artculos artisticos, deportivos, electrnico y de difcil reposicin, cuyo valor unitario sea MENOR DE 500 das del salario mnimo vigente en el D.F. Al momento de la contratacin.

    C. Dinero, ttulos de crdito, chequres, letras y pagars que en total no superen a MENOR A 150 das del salario mnimo vigente en el D.F. Al momento de la contratacin.

    INCISO 2Deportivos o de difcil reposicin con valor unitario o juego sea SUPERIOR A 500 das de salario mnimo vigente en el Distrito Federal en la fecha de contratacin. Cuadros,tapetes artculos de cristal, equipos fotogrficos instrumentos musicales

    INCISO 3Piezas o artculos de oro o plata, armas, colecciones de cualquier tipo, pieles, piedras preciosas,

    Clasifica los bienes asegurables en tres

    categoras:

    domstico o familiar.Los bienes asegurados bajo los incisos 1 y 2debern enumerarse unitariamente, enrelacin detallada y valorizada que seagregar a la pliza; adems debern estarrespaldadas con factura o avalo.INCISO 1.- Menaje de casa como muebles,enseres, artculos artsticos, deportivos,dineroen efectivo y se describen como:a) Se agrupan los bienes denominadosmenaje de casa como muebles, enseres,artculos de uso domstico, ropa y efectospersonales.b) Artculos artsticos, deportivos o de difcilreposicin que tengan un valor, por unidad ojuego, no mayor a 500 DSMVGDFc) Dinero, ttulos de crdito, cheques, letras ypagars que en total no sumen ms de 150DSMGVDFINCISO 2.- Artculos artsticos, deportivos o dedifcil reposicin que tenga un valor por unidado por juego, mayor de 500 DSMGVDF.Cuadros,tapetes,gobelinos,artculos de cristal,porcelanas, biombos, equipos fotogrficos ocinematogrficos, instrumentos musicales oartculos de difcil o imposible reposicin.INCISO 3.- Joyas, piezas o artculos de oro yplata, armas, colecciones de cualquier tipo,relojes, pieles y piedras preciosas.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Riesgos cubiertos.A. La prdida y/o daos de los bienescontenidos en la casa-habitacin y/o losdaos a la construccin material delinmueble a consecuencia de:

    Robo con violencia o intento de robo y/o Robo por Asalto o intento de Asalto

    Riesgos y Bienes excludos Robo sin violencia, extravo, desaparicin

    misteriosa Robo cometido por personas que dependan

    civilmente del Asegurdo (familiares,trabajadores, etc.)

    Actos blicos de cualquier naturaleza Bienes que se encuentren a la intemperie

    en patios, jardines y azoteas.

    Deducible y Participacin de laPerdida

    Determinacin de la Suma AseguradaLa correcta determinacin de la suma

    RIESGOS CUBIERTOS

    COBERTURA ADICIONAL

    Cubre la prdida o daos a consecuenciade asalto, entendindose por tal el roboperpetrado dentro del local asegurado,mediante la FUERZA FISICA O MORALsobre la persona.

    EXCLUSIONES1. Robo sin violencia2. Robo cometido por personas que dependan

    civilmente del asegurado3. Actos blicos de cualquier naturaleza4. Bienes que se encuentren a la intemperie.

    Cubre la prdida y daos materiales abienes muebles o inmuebles, aconsecuencia de robo cometido conviolencia para pasar del exterior alinterior del local donde se encuentranlos bienes, dejando seales visibles deviolencia.

    Deducib les y coaseguros ap licab les a las cobertu ras Deducib le C oaseguro R obo en dom ic ilio M enaje de c as a (inc is o 1 )

    10% s obre la prd ida que R es to de b ienes 20%

    ROBO CON VIOLENCIA

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT164

    La correcta determinacin de la sumaasegurada resultar de seguir los siguientespasos:

    1.El asegurado deber estimarrazonablemente, cunto es lo mximo quepodra representar la prdida por robo,considerando los artculos existentes en sudomicilio a valor usado, ya que la coberturade robo no indemniza a Valor de reposicin(viejo por nuevo). Esta deber de ser lasuma asegurada.

    2.Verificar que dicha suma no sea inferior almnimo a primer riesgo que establececada compaa, segn sus propias polticasinternas.

    3.Mnimo a Primer riesgo. Si al ocurrir unsiniestro la suma asegurada es igual osuperior al mnimo fijado por la compaa,se indemniza el total de las prdidas(descontado deducible y/o participacin delasegurado en la prdida), hasta agotar lasuma asegurada. En caso de que no secumpla esta condicin, se aplicar laclausula de proporcionalidad.

    4.Clusula de Proporcionalidad. Significaque, si al ocurrir el siniestro el valor real delos bienes resulta superior a la sumaasegurada, los daos sern indemnizadosen la misma proporcin que guarda la sumaasegurada respecto al valor de los bienes.

    R esto de b ienes 20% s obre la prd ida

    MINIMO A PRIMER RIESGO

    Mnimo a Primer Riesgo $10,000

    Suma Asegurada $12,000

    Siniestro $6,000

    Menos deducible (10% sobre la suma asegurda) $1,200

    Total indemnizable $4,800

    Ejemplo:

    CLAUSULA DE PROPORCIONALIDAD

    Valor real de los bienes $40,000

    Suma Asegurada $8,000

    Siniestro $6,000

    Base de Indemnizacin (20%) $1,200Menos deducible (10% de la S.A) $ 800

    Total indemnizable $ 400

    Ejemplo:

    Base de Indmnizacion

    =

    Proporcin de Suma Asegurada

    Valor de los bienes

    =

    8,000

    40,000

    =20%

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE ROTURA DE CRISTALESCobertura Bsica:Se ampara la rotura accidental del cristal o poractos vandlicos, as como el costo deinstalacin

    Cobertura Adicional: El costo de la remocin del cristal roto La rotura del cristal por reparaciones,alteraciones, mejoras y/o pintura del inmuebley/o cristal o cristales asegurados.

    Bienes cubiertos:Se cubren los cristales debidamente instalados en lacasa-habitacin, as como los cristales de interiores,ventanas, ventanales, domos.lunas y espejos, que selocalicen en el interior de la misma con espesormnimo de 4 mm.Tambin queda cubierta la remocin de los cristalesasegurados mientras stos no queden debidamentecolocados, as como los daos que sufran porreparaciones, alteraciones, mejoras y/o pintura de lacasa-habitacin y/o de los propios cristales.

    Bienes Excluidos:Vajillas, lmparas, candiles, otros objetos de adorno El cristal con espesor menor a 3 mm.

    Riesgos Cubierto:SE AMPARA LA ROTURA ACCIDENTAL POR RIESGOS

    SE AMPARA LA ROTURA ACCIDENTAL

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Se ampara los cristales instalados en el edificio y que formen parte de el, a condicin de que su espesor mnimo sea de 4 milmetros.Los cristales interiores (ventanas, ventanales, domos,lunas, cubiertas, espejos)

    I. Remocin de cristalII.Rotura por reparaciones,

    alteraciones, mejoras y/o pintura del inmuebles y/o cristal o cristales asegurados.

    BIENES CUBIERTOS

    I.- Rotura accidental de los cristales

    BIENES EXCLUIDOS

    Vajillas, lmparas, candiles, otros objetos de adorno El cristal con espesor menor a 3 mm.

    CCCC

    CCCCGGGGCTCTCTCTTTTT165

    SE AMPARA LA ROTURA ACCIDENTAL POR CUALQUIER CAUSA.LA COBERTURA INCLUYE LOS GASTOS DEINSTALACION

    Riesgos Excluidos:Raspaduras, ralladuras u otros defectossuperficiales,Daos que causen a terceros en sus bienes oen sus personas.Convenio Expreso:El acabado de los cristales teido, grabado,plateado, dorado

    Determinacin de la Suma AseguradaSe establece un porcentaje del valor del edificiopara cubrir los cristales que lo conforman. Si seha amparado los cristales de contenidos, lasuma asegurada ser un porcentaje de la sumaasegurada para contenidos.

    RIESGOS CUBIERTOS

    RIESGOS EXCLUIDOS1. RASPADURAS,2. MANCHAS3. DEFECTOS SUPERFICIALES, A MENOS QUE SE HAYA

    CONVENIDO EXPRESAMENTE4. DAOS QUE SUFRAN LOS BIENES ASEGURADOS DURANTE

    LAS MANIOBRAS DE REMOCIN, COLOCACIN ORECOLOCACIN DE LOS MISMOS.

    SE AMPARA LA ROTURA ACCIDENTALPOR CUALQUIER CAUSA.LA COBERTURA INCLUYE LOS GASTOSDE INSTALACION

    Deducibles y coaseguros aplicables a las coberturas Deducible Coaseguro Cristales 5% sobre la prdida con

    un mnimo de 2DSMGVDF

    El acabado de los cristales Teido,

    Grabado, Plateado, Dorado

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE DINERO YVALORESCobertura Bsica:Robo con violencia.Dentro de la casa-habitacin en caja fuerte (sino existe caja fuerte es necesario que elinmueble est totalmente cerrado y que no seencuentren los habitantes), se cubren losbienes contra:Robo por asalto estando los bienes dentro ofuera de cajas fuerteDaos materiales a las cajas fuerteconsecuencia del robo con violenciaIncendio y/o explosin, cuando los bienesestn dentro de cajas fuerte.Bienes Cubiertos:Se cubre el dinero en efectivo, en metlico o billetes

    de banco, valores y otros documentos negociables yno negociables propiedad del Asegurado con lmiteen la suma asegurada que se establece en lacartula y/o especificacin de la pliza, sin excederdel inters asegurable que el Asegurado tenga sobredichos bienes.

    Riesgos Cubiertos:Fuera del inmueble en trnsito fsicamente enpoder de los integrantes de la casa-habitacin

    POLIZA MULTIPLE FAMILIAR

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    RIESGOS EXCLUIDOS1. Robo o abuso de confianza de empleados y

    familiares,

    Dinero en efectivo en metlico o billete Letra de cambio, pagars, cheques, acciones, bonos financieros, hipotecarios o de ahorro y cdulas hipotecarias

    BIENES CUBIERTOS

    I.- Robo con violencia ( en caja fuerte)II.- Robo por asalto ( en caja o sin ella)III.-Daos materialesIV.- Incendio y/o explosin ( en caja)

    RIESGOS CUBIERTOS

    Robo con violencia o asalto Incapacidad fsica de la persona porteadora Accidente de la unidad porteadora

    CCCC

    CCCCGGGGCTCTCTCTTTTT166

    poder de los integrantes de la casa-habitacino de cualquier empleado domstico delasegurado:

    Robo con violencia o asalto Incapacidad fsica de la persona

    porteadora Accidentes del vehculo que

    transporta a las personasresponsables del manejo de losbienes asegurados

    Riesgos excluidos Robo o abuso de confianza de

    empleados y familiares. Robo sin violencia, desaparicin

    misteriosa o extravo

    Determinacin de la Suma AseguradaSe Institucin establece un lmite mximo deresponsabilidad tanto en efectivo como envalores y documentos.

    Deducibles y coaseguros aplicables a las coberturas Deducible Coaseguro

    Dinero y valores 10% de la prdida con mnimo de 50 DSMGVDF

    2. Robo sin violencia, desaparicin misteriosa o extravo

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE EQUIPOELECTRODOMSTICO YELECTRNICOCobertura Bsica:

    Impericia, descuido o sabotajeCorto circuito, perturbaciones por camposmagnticos, sobretensiones causadas porrayo.Defectos de mano de obra o montajeincorrectoRotura por fuerza centrfugaCuerpos extraos que se introduzcan en losbienes aseguradosExplosin de los bienes aseguardosRobo con violencia y asaltoBienes asegurados:Aparatos electrnicos de uso domstico en elhogar, como: aspiradoras, congeladores,estufas elctricas, mquinas tejedoraselctricas, pulidoras de pisos, ventiladores,lavadoras de ropa, lavadoras de platos,secadoras de ropa, compresores de aire parapintura y aire acondicionado, antenasparablicas, equipos de filmacin yproyeccin, equipos de grabacin y sonido,mquinas de escribir elctricas,microcomputadoras, televisores y video-

    POLIZA MULTIPLE FAMILIAR

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    BIENES ASEGURADOS

    Aparatos elctricos yelectrnicos de uso cotidianoen el hogar,

    BIENES EXCLUIDOS Equipos tomados enarrendamiento y los equipos

    con antiguedad mayor a 10

    Impericia, descuido o sabotajeCorto circuito, perturbaciones porcampos magnticos,sobretensiones causadas por rayo.Defectos de mano de obra omontaje incorrectoRotura por fuerza centrfugaCuerpos extraos que seintroduzcan en los bienesaseguradosExplosin de los bienesaseguardosRobo con violencia y asalto

    CCCC

    CCCCGGGGCTCTCTCTTTTT167

    microcomputadoras, televisores y video-caseteras.

    Bienes Excluidos: Equipos tomados en arrendamiento y losequipos con antiguedad mayor a 10 aos.Riesgos Exclusiones Errores de diseo, defectos de material o defabricacin y daos por los cuales sea legal ocontractualmente responsable el proveedor ofabricanteGastos normales de mantenimientoEquipos tomados en arrendamientoEquipos con antigedad mayor de 10 aosRobo, asalto o desaparicin misteriosaDesgaste por el uso normal, depreciacin, opor volverse obsoleto.Daos estticos o superficiales (rayaduras,manchas)Robo cometido por personas que dependancivilmente del asegurado.

    DETERMINACION DE LA SUMAASEGURADA.Deber establecerse como Suma Aseguradala que corresponda al valor de reposicin ,esto es: la cantidad necesaria para reponerlos bienes por otros de igual clase y calidad,a valor de nuevo, sin considerar depreciacinpor uso.En prdidas parciales: No se har reduccinpor concepto de depreciacin.En prdidas totales: Se indemnizar a valorreal, la prdida ser considerada como tal.

    Deducibles y coaseguros aplicables a las coberturas Deducible Coaseguro Equipo electrodomstico y electrnico

    15 das de salario mnimo general vigente

    10 o 20% sobre la prdida

    con antiguedad mayor a 10aos.

    RIESGOS EXCLUIDOS

    Errores de diseo, Gastos normales de mantenimientoEquipos tomados en arrendamientoEquipos con antigedad mayor de 10 aosRobo, asalto o desaparicin misteriosaDesgaste por el uso normal, depreciacin, o por volverse obsoleto.Daos estticos o superficiales (rayaduras, manchas)Robo cometido por personas que dependan civilmente del asegurado.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    BIENES ASEGURABLES DE LA POLIZADE RESPONSABILIDAD CIVIL;Basada en el Principio Legal de laresponsabilidad El que obrando ilcitamente ocontra las buenas costumbres cause dao aotro, est obligado a repararlo, a menos quedemuestre que el dao se produjo comoconsecuencia de culpa o negligenciainexcusable de la vctimaTiene la condicin de Asegurado la personacuyo nombre y domicilio se indica en pliza,con respecto a su responsabilidad civil por:Actos propios y de toda aquella persona quehabite permanentemente en el domicilio delasegurado, que dependan econmicamente del y por los que legalmente deba responderfrente a terceros.Las personas citadas anteriormente en ningncaso podrn ser consideradas como terceros.

    Cobertura Bsica:Daos causados a terceros en sus bienes ypersona, que sean responsabilidad delasegurado, cuando este desarrolle susactividades familiares y privadas.

    Actividades cubiertas:Como propietarios Como jefe de familia (las actividades quedesarrolle con su familia y de los actos de sus

    POLIZA MULTIPLE FAMILIAR

    RESPONSABILIDAD CIVIL

    ASEGURADO

    Contratante de la plizaPersonas que dependan civilmente del asegurado Aquellas que tienen una relacin laboral con el

    TERCERO .

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Persona ajena a los asegurados que sufre un dao por sus acciones Aquellas con siderada dependiente civil o econmicamente del asegurado.

    Se ampara la responsabilidad civil del asegurado por daos no intencionales causados a terceros en sus bienes o en su persona

    CCCC

    CCCCGGGGCTCTCTCTTTTT168

    desarrolle con su familia y de los actos de susdependientes econmicos). Como propietaro de una o varias viviendas(incluye las destinadas a vacaciones), suscocheras, jardines, piscinas, antenas,instalaciones de seguridad y demspertenencias y accesorios. Daos ocasionados por incendio o explosinde su vivienda. Daos por derrame de agua, accidental eimprevisto Por la prctica de deportes como aficionado. Por el uso de patines, bicicletas,embarcaciones de pedal o de remo y vehculosmotorizados que no necesiten placa paracircular. Por la tenencia de armas blancas (de aire ode fuego) para fines de cacera o tiro al blanco,cuando estn legalmente autorizadas. Como propietario de animales domsticos,de caza o guardianes. Durante viaje de vacaciones, estudios o deplacer dentro de territorio nacional. Siniestros ocurridos durante viajes devacaciones, de estudio o de placer en elextranjero.

    relacin laboral con el asegurado econmicamente del asegurado.

    Daos causados a terceros en sus bienes y persona, responsabilidad del asegurado.

    COBERTURAADICIONAL

    Viajes de estudio, devacaciones o de placer fuerade la Repblica Mexicana

    Obras, construcciones,ampliaciones o demoliciones

    R.C. Arrendatario.- Losdaos ocasionados porincendio o explosin, quesean responsabilidad delasegurado, al inmuebletomado en arrendamientopara ser usado comohabitacin.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE RESPONSABILIDAD CIVILCondmino: Responsabilidades descritas comopropietario de casa habitacin. Daos que causen a las reas comunes delcondominio y sean responsabilidad delasegurado. De la indemnizacin se descontarel porcentaje que corresponda al aseguradocomo propietarios de las reas comunes.Arrendatario: Responsabilidades descritas comopropietario de casa habitacin. Daos que causen al inmueble arrendadopor incendio o explosin, cuando seanresponsabilidad del aseguradoCobertura Adicional:Las responsabilidades derivadas de:

    Obras, construcciones, ampliaciones odemoliciones

    R.C. Arrendatario.- Los daos ocasionadospor incendio o explosin, que seanresponsabilidad del asegurado, al inmuebletomado en arrendamiento para ser usadocomo habitacin.EXCLUSIONES:

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    ACTIVIDADES CUBIERTAS

    PROPIETARIO CONDMINO ARRENDATARIO

    Como jefe de familiaComo propietaro deuna o varias viviendasDaos ocasionados porincendio o explosin desu vivienda. Daos por derrame deagua,Por la prctica dedeportes comoaficionado. Por el uso de patines,bicicletas, que nonecesiten placa paracircular. Por la tenencia dearmas blancasComo propietario deanimales domsticos, decaza o guardianes.Siniestros ocurridosdurante viajes devacaciones,

    Responsabilidades descritas comopropietario de casahabitacin. Daos quecausen a las reascomunes delcondominio y seanresponsabilidad delasegurado.

    Responsabilidadesdescritas comopropietario de casahabitacin. Daos quecausen al inmueblearrendado porincendio o explosin,cuando seanresponsabilidad delasegurado

    CCCC

    CCCCGGGGCTCTCTCTTTTT169

    EXCLUSIONES:Incumplimiento de contratos o conveniosMultas convencionales por el incumplimientode contratosUso, propiedad o posesin de embarcaciones,aeronaves o vehculos terrestres de motor queno requieran de placa para su empleo enlugares pblicosDaos ocasionados dolosamenteDaos sufridos por familiares o parientes delasegurado que habiten permanentemente conlParticipacin en apuestas, carreras, concursoso competencias deportivasResponsabilidades por daos a causa deinconsistencia, hundimiento o asentamiento delsuelo o del subsuelo, o a causa de falta oinsuficiencia de obras de consolidacin paraevitar la prdida de sostn en el suelo osubsuelo de propiedades vecinasActos blicosResponsabilidades imputables de acuerdo conla legislacin laboralResponsabilidades derivadas del ejercicio deculquier profesin, cargo u oficio (incluyehonorarios).CONEVNIO EXPRESO:Bienes en poder del asegurado por arrendamiento, comodato, depsitos o disposicin de autoridad.

    Incumplimiento de contratos o conveniosMultas convencionales por el incumplimiento de contratosUso, propiedad o posesin de vehculos terrestres de motor que norequieran de placaDaos ocasionados dolosamenteDaos sufridos por familiares o parientes del asegurado que habitenpermanentemente con lParticipacin en apuestas, carreras, concursos o competenciasdeportivasResponsabilidades por daos a causa de inconsistencia, hundimiento oasentamiento del suelo o del subsuelo, de propiedades vecinasActos blicosResponsabilidades imputables de acuerdo con la legislacin laboralResponsabilidades derivadas del ejercicio de culquier profesin, cargo uoficio (incluye honorarios).

    Bienes arrendadosComodatoDepsitos o disposicin de autoridad

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    SECCION DE ACCIDENTESPERSONALES

    El propsito de incluir una cobertura de laoperacin de personas dentro de un paqueteesencialmente de la operacin de daos, esotorgar una mayor proteccin al aseguradocubriendo, principalmente, a los trabajadoresque se encuentran bajo su servicio de manerapermanente y que de alguna manera, formanparte de su responsabilidad.

    Cobertura Bsica:Cubre la muerte accidental o las prdidas orgnicas del asegurado y sus dependientes econmicos, seimpre que ocurra dentro de los 90 das siguientes al accidenteACCIDENTE: Lesin corporal sufrida involuntariamente por la servidumbre o empleado del asegurado y causada por hechos externos, violentos, fortuitos e imprevistos o por actos no intencionales.Doble Indemnizacion:Se pagar cuando el accidente ocurra.:

    POLIZA MULTIPLE FAMILIAR

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Ambas manos, ambos pies o la vista de ambos ojos

    100% Ambas manos, ambos pies o la vista de ambos ojos

    100%

    ACCIDENTE

    Es aqul acontecimiento proveniente de una causa externa, sbita yviolenta que produce lesiones corporales o la muerte del asegurado.

    COBERTURA BASICA

    MUERTE ACCIDENTAL

    COBERTURAS OPCIONALES

    PERDIDAS ORGANICAS

    INCAPACIDAD POR ACCIDENTE

    GASTOS MEDICOS POR ACCIDENTE

    ESCALA DE INDEMNIZACION A

    ESCALA DE INDEMNIZACION B

    CCCC

    CCCCGGGGCTCTCTCTTTTT170

    Se pagar cuando el accidente ocurra.:a) Viajando como pasajero de transporte pblico regular, con ruta e itinerarios fijos, excepto trasporte areob) Viajando en un ascensor de servicio pblico, excepto minas, plataformas marinas.c) En un teatro, hotel o edificio pblico, provocado por incendio.Bienes Cubiertos:

    Asegurado y dependientes econmicosRiesgos Cubiertos:Muerte accidental. Si comoconsecuencia del accidente sufrido por elAsegurado y dentro de los 90 dassiguientes a la fecha del mismosobreviene la muerte, la Compaapagar a los beneficiarios, el importe dela suma asegurada mxima establecidapor persona en la cartula de la pliza. Gastos Mdicos del personal domstico.-Al servicio del asegurado, comoconsecuencia de un accidente (hasta 10das despus del mismo) o de cualquierotra causa por concepto de tratamientomdico o intervencin quirrgica,hospitalizacin, enfermeros, ambulanciao medicinas.

    vista de ambos ojosUna mano y un pie 100%

    Una mano o un pie y la vista de un ojo

    100%

    Una mano o un pie 50%

    La vista de un ojo 30%

    El pulgar de cualquier mano

    15%

    El ndice de cualquier mano

    10%

    Una mano y un pie 100%

    Una mano o un pie y la vista de un ojo

    100%

    Una mano 50%

    Tres dedos comprendiendo el pulgar o el ndice de una mano

    30%

    Tres dedos que no sean el pulgar o el ndice de una mano

    25%

    El pulgar y otro dedo que no sea el ndice de una mano

    25%

    El ndice y otro dedo que no sea el pulgar de una mano

    20%

    El pulgar de cualquier mano 15%

    El dedo medio, el anular o el meique

    5%

    Un pie 50%

    La vista de un ojo 30%Amputacin parcial de un pie, comprendiendo todos los dedos

    30%

    Sordera completa de los odos 25%

    Acortamiento de un miembro inferior, por los menos 5 cm.

    15%

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Bienes Excluidos:o Enfermedad corporal o mental, infecciones o tratamientomdico o quirrgico que no sea consecuencia del accidente.oLesiones que sufra el asegurado en servicio militar, actosde guerra, insurreccin, rebelin, revolucin, ria o actosdelictuosos.oHomicidio intencional, suicidio o intento del mismo,mutilacin voluntaria an estando en estado de enajenacinmental.o Hernia y eventracionesoEnvenenamientooAbortoso Mientras se encuentre el Asegurado en funciones comopiloto, mecnico en vuelo o miembro de la tripulacin de unaaeronave

    o Taxis areos o aeronaves que no pertenezcan a una lneacomercial legalmente constituidao Ocupantes de vehculos en competenciaso Motocicletas y similareso Desarrollo de actividades propias de su profesin u oficios(como operador de maquinaria pesada, instalador de torre oestructuras metlicas, cirquero, torero, boxeador, buzo,minero, electricista, paracaidista o alpinista.

    Asistencia Legal

    POLIZA MULTIPLE FAMILIAR

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    ASEGURADO DEBER ASEGURADORA

    CCCC

    CCCCGGGGCTCTCTCTTTTT171

    La Compaa pone a disposicin del Asegurado su cuerpoespecializado de abogados, a fin de que lo asesoren y asistan en larealizacin de los trmites que procedan ante las autoridadescorrespondientes, con motivo de un siniestro en cualquiera de lassecciones contratadas en esta pliza.ExclusionesCuando el siniestro ocurra por cualquier otro riesgo distinto a los quese encuentren cubiertos bajo esta plizaCuando el Asegurado no obedezca las instrucciones de los abogadosde la CompaaEn caso de que el Asegurado oculte a los abogados de la Compaa,cualquier informacin relacionada con el siniestroCuando el Asegurado no comparezca ante las autoridades que lociten

    Procedimiento en caso de siniestro1. Medidas de salvaguarda o recuperacin.Al tener conocimiento de un siniestro producido por alguno

    de los riesgos amparados por esta pliza, el Aseguradotendr la obligacin de ejecutar todos los actos que tiendan aevitar o disminuir el dao.2. AvisoAl ocurrir algn siniestro que pudiera dar lugar aindemnizacin conforme a este seguro, el Asegurado tendrla obligacin de comunicarlo por escrito a la Compaa, ams tardar dentro de las 24 horas siguientes a partir delmomento en que tenga conocimiento del hecho, salvo casode fuerza mayor.3. Derechos de la CompaaLa Compaa podr optar por sustituirlos o repararlos asatisfaccin del Asegurado, o bien, pagar en efectivo el valorque corresponda.

    VII.3 SINIESTROS

    ASEGURADO

    Declaracin del asegurado

    DEBER INFORMAR

    ASEGURADORA

    DENTRO DE LAS 24 HRS. SIGUIENTES AL MOMENTO QUE LA

    CONOZCA

    Si no hay peligro de demora, pedirinstrucciones a la empresa aseguradora,debiendo atenerse a las que ella le indique.

    Fecha de ocurrencia del siniestro Hora del siniestro aproximada Monto aproximado de los daos Decripcin de los hechos Causas posibles de las prdidas

    Formato solicitud de reclamacin de siniestro

    Nmero de pliza

    Vigencia de pliza

    Ubicacin del negocio

    Decsripcin de hechos

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    A. A. Documentos que el Asegurado o el beneficiario debenrendir a la Compaa

    1. Para todas las secciones de esta pliza (excepto parala seccin de Responsabilidad Civil Familiar):Estado de los daos causados por el siniestroNotas de compra-venta o facturas o certificados de avaloRelacin detallada de todos los seguros que existan sobre losbienesDatos relacionados con las circunstancias en las que se produjo elsiniestro y copias certificadas de las actuaciones practicadas por elMinisterio Pblico, o por cualquier otra autoridad que hubiereintervenido en la investigacin, con motivo de la denuncia que deberpresentar el Asegurado acerca del siniestroPresupuestos de reparacin del equipo electrodomstico y/oelectrnico

    2. Para Robo de Contenidos: Copia certificada de la averiguacin previaDocumentacin que la compaa considere necesaria para acreditar:Procedencia de la reclamacinPreexistencia de los bienesValor de reposicin

    Considerndose vlidos para cumplir con lo anterior:Carta de preexistencia, con la descripcin de los artculos, as como

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    Pliza completaActa del Ministero Pblico o autoridad que haya dado fe de los hechos Acta de bomberos o proteccin civil Relacin detallada de la existencia de otros seguros. Facturas, avalos o notas de compra venta de los bienes perdidos o daados. Planos del inmueble daado (incendio) Relacin detallada de los bienes daados o perdidos con su descripcin y monto de la prdida estimada.

    Documentacin:

    CLUSULAS:

    Aviso de Siniestro.- 24 horas

    CCCC

    CCCCGGGGCTCTCTCTTTTT172

    Carta de preexistencia, con la descripcin de los artculos, as comola firma de dos testigos que avalen la preexistencia y propiedad delos bienes robados. Slo podrn fungir como testigos, aquellaspersonas que sean mayores de edad, que se puedan identificar concredencial de elector vigente y no sean familiares directos oindirectos del asegurado. Constancia visual (video, fotografa) en donde se muestre elartculo, en el interior del inmueble asegurado o a la persona usandoel artculo.

    Para la Responsabilidad Civil Familiar.Disposiciones en caso de siniestro.Aviso de reclamacin:El Asegurado se obliga a comunicar a la Compaa, tan pronto tengaconocimiento, las reclamaciones o demandas recibidas por l o susrepresentantes, a cuyo efecto, le remitir los documentos o copia delos mismos y la Compaa se obliga a manifestarle, de inmediato ypor escrito, que no asume la direccin del proceso, si sta fuere sudecisin.

    Cooperacin y asistencia del Asegurado con respecto a laCompaa:A proporcionar los datos y pruebas necesariasA ejercitar y hacer valer las acciones y defensas que le correspondanen derechoA comparecer en todo procedimientoA otorgar poderes a favor de los abogados que la Compaa designe.

    Inters Moratorio.-(Art.71 L.S.C.S) queda obligada a pagar estos equivalentes a la media aritmtica de las tasa de rendimiento brutas a CETES emitidas durante la mora.

    Peritaje o Controversia.-Desacuerdo - perito

    Salvaguarda y Recuperacin.-

    OBLIGACIN DE:Ejecutar todos los actos que tiendan a evitar o disminuir

    el dao.

    Los gastos que no sean improcedentes, se

    cubrirn por la Institucin.y si ella da

    instrucciones, anticipar dichos

    gastos.

    ASEGURADO

    Si no hay peligro dedemora, pedirinstrucciones a laempresa aseguradora,debiendo atenerse a lasque ella le indique.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT173

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    VIII.1 CONCEPTOS BASICOS

    AVENTURA MARTIMA

    CASCO

    PRDIDA

    Se considera que existe aventura martima:Cuando el buque est expuesto a a los riesgos martimos. El perodo en el cual laembarcacin est expuesta a los peligros de navegacin.

    El casco es el propio buque, incluye: la instalacin elctrica no conectada al motorprincipal, las calderas auxiliares con sus condensadores, gras, molinete, sermotor deltimn y la instalacin y maquinaria frigorfica.

    Es la carga (normalmente agua de mar y/o agua aceitosa) que lleva una embarcacinpara faciitar la conduccin y estabilidad del barco.

    La actividad que realiza una embarcacin para trasladarse por agua de un punto aotro, con rumbo y fines determinados. Cabotaje, Interior, Altura y Trnsito Terrestre

    Se considera prdida cualquier dao cuya causa inmediata (prxima) sea un riesgocubierto por el seguroPrdida real o absoluta.- Si la embarcaccin es destruida o daada hasta el punto deverse privada de su naturaleza inherente o si el asegurado se ve desposedoirreparablemente de ella.

    LASTRE

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    NAVEGACIN

    CCCC

    CCCCGGGGCTCTCTCTTTTT174

    Prdida constructiva.- Cuando la embarcacin ha sido daada a tal punto que lareparacin sobrepase el costo de la misma.Implcita.- Cuando el asegurado el privado del uso normal del buque, a consecuenciade un dao.Parcial.- Toda prdida que no se considere o no puedea ser declarada como total, seconsiderar prdida parcial.Por Avera Particular.- Es considerada como una prdida parcial causada por un riesgogarantizado en el contrato de seguro

    Responsabilidades por daos a accidentes a otros buques,prdida de vidas, daospersonales o enfermedades, incluyendo gastos por salvamento de vidas, de los quesea legalmente responsible el asegurado.Cobertura Adicional: Se considera tercero los buque hermanos. Costas legales al disputar responsabilidad o por haberse entablado proceso paralimitar responsabilidades, As como las costas por representacin en pesquisa judicial oinvestigacin de accidente fatal.

    Se entender por peligros de los mares, ros, lagos u otras aguas navegables, como:Mal tiempo o tempestad, colisin o abordaje, Varadura o encallamiento, hundimiento ozozobra.

    RESPONSABILIDAD CIVIL

    PELIGRO DE LOS MARES

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CONCEPTOS ESPECIFICOS

    Llamadas as para diferenciarlas de lasdems embarcaciones, que aunque sonpequeas, su uso es muy variable. Las haypara ser utilizadas para transportarmercancas aseguradas al buque o viceversa.

    Dentro de las embarcaciones de placerexisten algunas diferencias sobre todo encuanto a tamao y nmero de plazas, que serefiere a asientos o lugares a ocupar por lostripulantes.

    Algunas de ellas son:Lancha: es la menor de las embarcaciones.Su capacidad es de mximo 4 personas.Velero: Su nombre viene de que sumovimiento principal radica en la fuerza delviento sobre la vela.Yate: Los hay desde 6 simples plazashasta yates con camarotes, compartimientopara jets sky y un sin nmero de lujos.

    EMBARCACIONES MENORES DE PLACER

    EMBARCACIONES MENORES DE PLACER

    Es la menor de las

    embarcacion

    Su nombre viene de que

    su

    Los hay desde 6 simples

    Tambin llamadas lanchas

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT175

    para jets sky y un sin nmero de lujos.Lancha rpida: Tambin llamada lanchadeportiva de motor. En competencias es paraun solo tripulante. En cuestin de placer hastade 4 plazas.

    Normalmente estas embarcaciones de placernavegan en aguas tranquilas sin metersemucho a mar abierto, pero no estn exentasde sufrir daos los ms comunes son:

    + Avera particular: consiste en indemnizarlos daos:

    1.- Cuando stos exceden del deducible y

    2.- Cuando los daos no alcanzan lacategora de prdida total.+ Abordaje: La accin de la colisin de lasembarcaciones al entrar en contacto con otraembarcacin y chocar las bordas ( orillas delas embarcaciones) es lo que se conoce comoabordaje.

    embarcaciones. Su

    capacidad es de mximo 4

    personas.

    su movimiento

    principal radica en la fuerza del

    viento sobre la vela

    simples plazas hasta

    yates con camarotes.

    Dao producido INTENCIONADAMENTE enun buque o en las mercancias que transportapara evitar otros mayores en el propio buqueo en su carga.Su cuanta se distribuye proporcionalmente

    entre las partes beneficiadas de esa conductaintencionada (dueo del buque, propietario dela mercancia, asegurador, fletador. Etc.)

    Dao producido ACCIDENTALMENTEen un buque o en su carga.Su cuanta slo afecta al propietario (o

    asegurador) de los bienes daados.

    lanchas deportiva de

    motor

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    + Encallamiento: Una embarcacin puedequedar suspendida o atorada en coral,arrecife, roca y es cuando sabemos que laembarcacin encall.+ Varadura: es un trmino muy parecido alanterior, pero la mayora de las veces lavaradura se da en arena, lodo y a veces enfango.+ Casco: con frecuencia omos que se da

    el casco de la embarcacin; esto se refiere ala estructura de la embarcacin, que confrecuencia estn hechas de fibra de vidrio.+ Motor fuera de borda: el motor de laembarcacin en este caso no est integrado ala estructura de la embarcacin.

    TIPOS DE NAVEGACIONCon todo y lo que comentamos en prrafosanteriores dependiendo de la embarcacin ydel tipo de radio navegacin con que cuentan,algunas embarcaciones, sobre todo yates deplacer, pueden emprender largas travesas yentonces dan a lugar los siguientes tipos denavegacin:

    EMBARCACIONES MENORES DE PLACER RIESGOS

    ABORDAJE Es la accin de la colisin de las embarcaciones al entrar en contacto con otra embarcacion y chocar las bordas(orillas de las embarcaciones)

    ENCALLAMIENTO Una embarcacin puede quedar suspendida o atorada en coral, arrecife roca.

    VARADURA Una embarcacin puede quedar suspendida o atorada ARENA, LODO Y A VECES EN FANGO.

    CASCO Se refiere a la estructura de la embarcacin, que con frecuencia etn hechas de fibra de vidrio.

    MOTOR FUERA DE BORDA

    El motor de la embarcacin en este caso no esta integrado a la estructura de la embarcacin.

    TIPOS DE NAVEGACION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT176

    + Interior: Es cuando la embarcacindesarrolla paseos dentro de los lmites de lospuertos en ros, lagos, presas y lagunas.+ Cabotaje: Ahora la embarcacinemprende travesas en mar, pero solamenteen puertos del mismo litoral.+ Altura: En este caso la embarcacintraspasa los lmites territoriales de sunacionalidad.+ Trnsito terrestre: Las embarcaciones( lanchas, veleros y yates menores de placer)tambin suelen ser transportadas por tierra, abordo de remolques y por supuesto quepueden sufrir daos.MARCO LEGAL.En la mayora de las actividades del serhumano, por no decir que en todas,intervienen ciertas leyes; en este caso no esla excepcin y veremos las leyes mscomunes que regulan+ LEY DE NAVEGACIN Y COMERCIOMARTIMO:De acuerdo a la la ley de navegacin en elTtulo segundo, Captulo I Artculo 9 ; lasembarcaciones se clasifican por su uso en:De transporte de pasajerosDe transporte de cargaDe pesca

    INTERIOR TRANSITO TERRESTRE

    ALTURA o INTEROCENICA

    CABOTAJE

    Es cuando la embarcacin

    desarrolla paseos

    dentro de los lmites de los puertos en ros, lagos,

    presas y lagunas.

    Cuando la embarcacin

    emprende travesas en

    mar, pero solamente en puertos del

    mismo litoral

    La embarcacin transpasa los

    lmites territoriales

    de su nacionalidad

    Las embarcaciones tambin suelen

    ser transportadas por tierra, a

    bordo de remolqes y por supuesto que pueden sufrir

    daos.

    QU LEY REGULA A LAS EMBARCACIONES MENORES DE PLACER?

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    De recreo y deportivasEspecialesDe acuerdo al Ttulo Primero. Captulo I.

    Artculo 1:El objeto de esta ley es regular las vas

    generales de comunicacin por agua, lanavegacin y los servicios que presta.

    De acuerdo al Ttulo Primero. Captulo II.Artculo 7:

    La Secretara de Comunicaciones yTransportes es quien otorga los permisos yautorizaciones de navegacin y para prestarservicios en las vas generales decomunicacin.

    De acuerdo al Ttulo Sexto. Captulo II.Artculo 115:Define la avera comn o gruesa y la averaparticular.

    Como dice el Ttulo Primero. Captulo II.Artculo 7 la Secretara de Comunicaciones yTransportes es la que otorga los diferentespermisos:+ Certificado de matrcula:

    EMBARCACIONES MENORES DE PLACER

    QUIN OTORGA LOS PERMISOS Y AUTORIZACIONES DE NAVEGACION Y PRESTACION DE SERVICIOS EN LAS VIAS DE

    COMUNICACION?

    CERTIFICADO DE MATRICULA

    En donde se establece lamarca, modelo y capacidad dela embarcacin.

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT177

    + Certificado de matrcula:Como en autos existe una tarjeta de

    circulacin en las embarcaciones existe uncertificado de matrcula en donde seestablece la marca, modelo y capacidad de laembarcacin.+ Certificado de seguridad martima:Muchas embarcaciones llegan a Territorio

    Nacional procedentes de varios Pases delmundo y al entrar a puerto Mexicano o MarinaMexicana tiene que registrarse para evitarviolaciones de ley.

    + BIENES CUBIERTOS:Sern la embarcacin o embarcaciones

    propiedad del asegurado por las cuales sealegalmente responsable.+ BIENES EXCLUIDOS:Embarcaciones que carezcan del certificado

    de matrcula.Y aquellas que hayan sido internadas en

    Territorio Nacional por medios ilcitos.

    MATRICULA la embarcacin.

    Muchas embarcaciones llegan aTerritorio Nacional procedentes devarios Pases del mundo y alentrar a puerto Mexicano o MarinaMexicana tiene que registrarsepara evitar violaciones de ley.

    CERTIFICADO DE SEGURIDAD MARITIMA

    Embarcacin o embarcaciones propiedad del asegurado por las cuales sea legalmente responsable.

    Embarcaciones que carezcan delcertificado de matrcula.Y aquellas que hayan sido internadas

    en Territorio Nacional por mediosilcitos.

    VIII.2 ESTRUCTURA DE LA PLIZA

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    CASCOEQUIPO DE RADIO Y RADARCUARTO DE MQUINASVELASMASTILCALDERATIMNSALVAVIDAS

    La Compaa en ningn caso ser responsable por prdidas o daos a:

    a. Combustibles, lubricantes y medios refrigerantes.b. La carga que sea transportada en la embarcacin asegurada.c. Vehculos terrestres que requieran placas, licencias o permiso para transitar.d. Cualquier tipo de herramienta, tubos para perforacin y tuberas de ademe.e. Equipos Porttiles para fotografa, medicin o topografa; excepto cuando hayan sido asegurados mediante convenio expreso en la cobertura de Daos o Prdidas a efectos personales y Deportivos.f. Llantas y bandas de hule, cables y cadenas de acero, que no formen parte integral de la embarcacin asegurada.g. Provisiones u objetos consumibles y elementos de amarre y fondeo, as como los

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    BIENES CUBIERTOS

    BIENES EXCLUIDOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT178

    g. Provisiones u objetos consumibles y elementos de amarre y fondeo, as como los accesorios de la embarcacin que no hayan sido declarados por separado con su respectiva Suma Asegurada al contratar la Pliza; excepto cuando hayan sido asegurados mediante convenio expreso en la cobertura de Daos o Prdidas a efectos Personales y Deportivos.h. Las velas, fundas, mstiles, arboladuras, aparejos y jarcias, daados por la accin de los vientos o del agua a menos que ocurra la prdida total de la embarcacin.i. Efectos personales como celulares, lentes para el sol, bolsos de mano, ropa, dinero a menos que se haya contratado mediante convenio expreso.j. Motores fuera de borda, excepto cuando se trate de prdida total de la embarcacin.k. Aparatos y equipos elctricos y/o electrnicos, incluyendo el cableado.l. La embarcacin mientras sea utilizada como vivienda permanente. m. Tripulacin

    Se podrn amparar mediante convenio, los siguientes BIENES:

    Efectos Personales o Deportivos El Remolque terrestre para transportar la embarcacin

    BIENES EXCLUIDOS QUE PUEDEN SER

    CUBIERTOS MEDIANTE CONVENIO

    EXPRESO

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    La prdida total, real o implcita de la embarcacin en los siguientes casos:

    A. Cuando se encuentre en mares, esteros, puertos, ros, canales lagos, lagunas, diques, varaderos, presas, drsenas y viaductos, causada por:

    i. Huracn, Granizo, Vientos Tempestuosos, Maremoto, Marejada, Nieve y/o Helada.ii. Incendio, Rayo y/o Explosiniii. Terremoto y/o Erupcin volcnicaiv. Anegacin por mal tiempov. Naves Areas y/u objetos cados de ellasvi. Entallamiento o Varadavii. Hundimiento y/o Colisin de la Embarcacin

    B. Durante su permanencia en tierra, cobertizos, garajes o sobre muelles destinados al estacionamiento, causada directamente por:

    i. Huracn, Granizo, Vientos Tempestuosos, Maremoto, Marejada, Nieve y/o Helada.ii. Incendio, Rayo y/o Explosiniii. Terremoto y/o Erupcin volcnicaiv. Anegacin por mal tiempov. Naves Areas y/u objetos cados de ellas

    C. Como Consecuencia de cualquier maniobra de entrada y salida del agua (botadura o montar en calzo o en cuna), siempre que dichas maniobras se efecten por tcnicos especializados.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    RIESGOS CUBIERTOS

    (Cobertura Bsica)

    CCCC

    CCCCGGGGCTCTCTCTTTTT179

    especializados.

    b) El robo total cuando la embarcacin se encuentre en tierra o a flote, amarrada o atracada en muelles, siempre que existan seales de violencia visibles en los accesos o se trate de un asalto, y la embarcacin se encuentre bajo custodia de una persona o autoridad competente.

    c) Los Gastos de Salvamento, Remolque o Auxilio en que incurra el asegurado para disminuir o evitar cualquier prdida o riesgo cubierto por la pliza.En caso de que la embarcacin se encuentre en la necesidad de ser remolcada y se solicite dicho servicio, la responsabilidad mxima de la Compaa ser de:

    - 12.00 USD (o su equivalente en pesos) Por Milla de Remolque - 60.00 USD (o su equivalente en pesos) Por Hora de Remolque.

    Queda entendido y convenido que el remolque se har al puerto ms cercano donde sea viable la reparacin de los daos. Si por alguna causa esto no fuera posible, el Asegurado convendr lo necesario con la Aseguradora; de lo contrario sta slo responder por el costo correspondiente de haber realizado el remolque al puerto ms cercano quedando a cargo del Asegurado la diferencia.d) Se cubren los gastos de remocin de restos por naufragio, siempre y cuando sea ordenado por autoridad competente. La Suma Asegurada ser del 25% del valor de la embarcacin o la que se seale en la cartula de la pliza

    COBERTURA DE RESPONSABILIDAD CIVIL: Tambin llamada PANDI

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    La compaa en ningn caso ser responsable por daos a los bienes asegurados causados directamente por, o a consecuencia de:

    a. Responsabilidades por el incumplimiento de cualquier contrato o convenio.b. Responsabilidades cuando la embarcacin est participando en cualquier tipo de exhibicin y/o competencia.c. Responsabilidades por daos ocasionados a terceras personas que intervengan en reparaciones o arrastre por tierra de la embarcacin asegurada.d. Responsabilidades por daos causados por la contaminacin del suelo, las aguas o la atmsfera.e. Dolo o mala fe del Asegurado, del beneficiario, de los causahabientes o de los apoderados de cualquiera de ellos (*).f. Daos por participacin en apuestas, carreras, concursos o competencias deportivas de cualquier clase, o de sus pruebas preparatorias.g. Los daos causados por la violacin del Asegurado a cualquier Ley, disposicin o reglamento expedidos por las autoridades, cuando la misma haya influido directamente en la realizacin del siniestro.h. Daos por errores de diseo, construccin y usos distintos para los que fue creada.i. Daos a plataformas petroleras.j. Indemnizaciones imputables al Asegurado de acuerdo a la Ley Federal de Estibadores y Trabajadores Portuarios, Las Leyes de indemnizacin por la incapacidad de Trabajadores u otra disposicin complementaria de dichas leyes.k. Multas y/o cualquier otra sancin de carcter penal impuesta por tribunales y/o autoridades.l. Daos materiales causados por apresamiento, confiscacin, destruccin o dao por barcos de guerra, revolucin, rebelin, insurreccin, piratera, apoderamiento, arrestos, restricciones, detenciones u otras actividades de guerra o beligerancia, incluyendo bombardeos areos, minas flotantes o estacionarias o torpedos perdidos o abandonados, as como por cualquier arma de guerra que emplee r3eaccin o fuerza, radioactiva o nuclear.

    ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    RIESGOS EXCLUIDOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT180

    arma de guerra que emplee r3eaccin o fuerza, radioactiva o nuclear.m. La prdida total, real o implcita de la embarcacin durante su permanencia en talleres o astilleros para su mantenimiento o reparacin.n. El robo total cuando la embarcacin se encuentre en clubes o marinas.o. Robo parcial y robo sin violencia.p. Abuso de confianza de las personas a quienes se les haya encargado la propiedad asegurada.q. Los robos cometidos a la embarcacin por los miembros de la familia del Asegurado, de las personas que de l dependan, empleados a representantes legales.r. Daos producidos cuando la embarcacin sea utilizada por personas no autorizadas por el Asegurado o que, autorizada por el mismo, carezca de licencia o permiso para su manejo, expedido por la autoridad competente, o el mismo haya sido suspendido o se encuentre caduco; siempre y cuando esto haya contribuido en la realizacin del siniestro.s. Desgaste normal, deterioro gradual (incluyendo vida marina), raspadura, abolladura, electrlisis, rotura mecnica, corrosin, cavitacin, oxidacin, polilla, insectos o roedores, humedad en la atmsfera o exposicin a los elementos de la naturaleza.t. Varadas de la embarcacin asegurada cuando ocurra en la desembocadura del Ro Colorado en el Golfo de California; el Puerto de San Felipe, Baja California; el Golfo de Sta. Clara, Baja California; la Baha de los ngeles, Baja California; Puerto Peasco, Sonora; Alvarado, Veracruz; Frontera, Tabasco; Puerto Ceiba, Tabasco; y el Puerto de Chicxulub, Yucatn. u. Echazn.V.Baratera del Capitn.w. Extravo.x. Quedan excluidos los actos de terrorismo de una o ms personas que procedan en nombre de organizaciones de cualquier tipo o en forma independiente; los cuales consistan en la utilizacin de explosivos, sustancias txicas, armas de fuego o que por incendio, inundacin, o cualquier otro medio violento, realicen actos en contra de las personas, la cosas o servicios pblicos, que produzcan alarma, temor, o terror en la poblacin o en un grupo o sector de ella, para perturbar la paz pblica, o tratar de menoscabar la autoridad del Estado, o presionar a la autoridad para que tome una determinacin.

    (*) Esta exclusin aplica para todas las coberturas de la Pliza, excepto para la de Huelgas y Alborotos Populares.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    RIESGOS EXCLUIDOS PERO QUE PUEDEN SER CUBIERTOS MEDIANTE CONVENIOEXPRESO:

    Avera ParticularAbordajeProteccin e Indemnizacin Simple (P&I Simple)Proteccin e Indemnizacin Completa (P&I Completa)Arrastre de la Embarcacin por TierraGastos Mdicos y Accidentes Corporales a OcupantesHuelgas y Alborotos PopularesDaos o Prdidas a Efectos personales y Deportivos

    El importe a indemnizar en caso de determinar prdida total real o prdida total implcita, en conjunto no exceder del valor real de la embarcacin.

    Para las siguientes coberturas se deben tener adems las siguientes consideraciones:

    Proteccin e Indemnizacin (P&I):En caso de muerte o incapacidad, la indemnizacin se cubrir de acuerdo a la legislacin del territorio en donde se presente la reclamacin.

    Esta cobertura aplica tambin cuando las embarcaciones pertenezcan total o parcialmente al Asegurado. En el caso de que ambas cuenten con seguro, esta cobertura operar en exceso.

    Gastos Mdicos y Accidentes Corporales.La responsabilidad mxima de la Compaa es de 25,000 USC y o su equivalente en

    RIESGOS EXCLUIDOS QUE PUEDEN SER

    CUBIERTOS MEDIANTE CONVENIO

    EXPRESO

    SUMA ASEGURADA E

    INDEMNIZACIONES

    CCCC

    CCCCGGGGCTCTCTCTTTTT181

    La responsabilidad mxima de la Compaa es de 25,000 USC y o su equivalente en moneda nacional por usuario u ocupante y los sublmites de esta Suma Asegurada son:

    Muerte 10,000 USC y/o su equivalente en moneda nacional.Incapacidad 10,000 USC y/o su equivalente en moneda nacional.Gastos Mdicos 5,000 USC y/o su equivalente en moneda nacional.

    En el caso de Indemnizacin por Muerte los siguientes casos, se indemnizar de acuerdo a la Ley Federal del Trabajo o a la Legislacin vigente anloga en el pas en el que haya ocurrido el accidente hasta el tope mximo establecido como sublmite de la cobertura por Muerte.

    - En caso de ser el Asegurado una persona fsica, responsabilidades derivadas de daos sufridos por: cnyuge, padres, hijos, hermanos, padres polticos, hermanos polticos, u otros parientes del Asegurado que habiten permanentemente con l.- En caso de ser el Asegurado una persona moral, responsabilidades derivadas de daos sufridos por: consejeros, directores, socios, administradores, gerentes u otras personas con funcin directiva, as como por sus cnyuges o parientes que habiten permanentemente con ellos.

    En el caso de cualquier pasajero cubierto que no sea contemplado en los dos puntos anteriores, se indemnizar de acuerdo a lo establecido en Cdigo Civil Federal vigente en la Repblica Mexicana o a la Legislacin vigente en materia de responsabilidad civil en el pas en el que haya ocurrido el acc8idente hasta el tope mximo establecido como sublmite de la cobertura por Muerte. La indemnizacin por los gastos mdicos, farmacuticos y de hospitalizacin operarn como reembolso, con el lmite por ocupante mencionado en la cartula y/o especificacin de la presente Pliza.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACIONASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES

    Si durante la vigencia de este seguro y como resultado directo de un accidente cubierto por estas condiciones sufrido por los pasajeros o la tripulacin cubiertos, dentro de los 90 das naturales siguientes a la fecha del mismo, la lesin produjera cualesquiera de las prdidas enumeradas en el Artculo 514 de la Ley Federal del Trabajo, la Compaa indemnizar en el mismo porcentaje y tomando como base lo establecido en el artculo 484 de la Ley Federal del Trabajo o a lo establecido en la Legislacin anloga vigente en el pas en el que haya ocurrido el accidente hasta el sublmite establecido para el riesgo de incapacidad.

    Por prdida de cualesquiera de las partes de un miembro citadas se entender la amputacin quirrgica. Traumtica o el anquilosamiento de esa parte completa; por prdida de un ojo se entender la prdida completa o irreparable de la funcin de la vista de ese ojo; por prdida del pulgar o ndice, la separacin o anquilosamiento de dos falanges completas de cada dedo.

    Si a consecuencia del mismo accidente que caus la incapacidad, se hubiesen hecho indemnizaciones por concepto de prdidas orgnicas, stas se deducirn de la indemnizacin que proceda por incapacidad.

    En caso de prdida anatmica o funcional de ms de un rgano o extremidad. La indemnizacin se determina por la suma de los porcentajes correspondientes a cada lesin marcados en la Ley Federal del Trabajo o a lo establecido en la Legislacin vigente anloga en el pas en el que haya ocurrido el siniestro, sin exceder del lmite mximo de responsabilidad para la cobertura de incapacidad.

    SUMA ASEGURADA E

    INDEMNIZACIONES

    CCCC

    CCCCGGGGCTCTCTCTTTTT182

    En caso de defectos fsicos o dolencias preexistentes en rganos afectados por un accidente anterior, slo se tendr derecho a la indemnizacin que corresponda a la diferencia entre el grado de invalidez preexistente y el que resulte despus del accidente cubierto por estas condiciones.

    Efectos Personales y DeportivosEn caso de prdida parcial, la indemnizacin corresponder a los gastos en que se incurra para dejar en condiciones de operacin similares a las existentes inmediatamente antes de ocurrir el siniestro.

    Cuando el costo de reparacin de un bien asegurado sea igual o mayor que su valor real, entonces se considerar una prdida total.

    En los casos de prdida o destruccin total, se indemnizar a valor real, sin exceder de la Suma Asegurada estipulada para esta cobertura.

  • ASESORES INTERDISCIPLINARIOS

    EN CAPACITACION

    Algunos elementos importantes para la suscripcin son:- Edad de la embarcacin:Cuando la embarcacin ya no rene las condiciones

    mnimas de seguridad la autoridad le retira elcertificado de matrcula.- Uso:En este seguro es exclusivo para recreo y placer.- Capacidad:

    El certificado de matrcula marca el nmero detripulantes que pueden ir en la embarcacin.- Aguas que trnsita:Se refiere a aguas Nacionales o Internacionales.- Mantenimiento:Este es bsico sobre todo para yates menores deplacer.- Lugar donde se guarda:Especificar claramente donde se guarda.- Estado fsico:

    EMBARCACIONES MENORES DE PLACER

    ELEMENTOS IMPORTANTES

    PARA LA SUSCRIPCION

    RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE RIESGOS INDIVIDUALES DE

    SEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOSSEGUROS DE DAOS

    CCCC

    CCCCGGGGCTCTCTCTTTTT183

    - Estado fsico:En ocasiones la Compaa puede solicitar fotografasde la embarcacin.

    DOCUMENTOS, DATOS E INFORMES QUE ELASEGURADO DEBE RENDIR A LA COMPAA.PARA LA VALUACION E INDEMNIZACION DE LASPERDIDAS.En caso de siniestro el asegurado debe rendir a la

    compaa toda clase de informacin relacionada conel siniestro y a peticin de sta copias certificadas delas actuaciones practicadas por las autoridades ascomo todo tipo de documentos que puedan apoyar lareclamacin del asegurado.

    VIII.3 SINIESTROSEn caso de siniestro el asegurado debe:Rendir a la compaa toda clase de informacinrelacionada con el siniestro y A peticin de sta copias certificadas de lasactuaciones practicadas por las autoridadesTodo tipo de documentos que puedan apoyar lareclamacin del asegurado.

    IMPORTANTE:Todas las partes de este manual, as como losmateriales complementarios (instruccionales ydidcticos) tienen Derechos Reservado medianteacta nmero 29537. La reproduccin de estosmateriales o de cualquiera de sus partes sin permisoescrito de Asesores Interdisciplinarios enCapacitacin,S.C. queda estrictamente prohibida.